EMAIL THIS PAGE TO A FRIEND

POLR2A

polymerase (RNA) II (DNA directed) polypeptide A, 220kDa

98 Gene Product Result for
Synonyms: POLR2 POLRA RPB1 RPBh1 RPO2 RPOL2 RpIILS hRPB220 hsRPB1
UniProtKB ID: P24928, A6NN93, B9EH88
Gene ID:
Human(5430) Summary: This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
Mouse(20020) polymerase (RNA) II (DNA directed) polypeptide A
Rat(363633) polymerase (RNA) II (DNA directed) polypeptide A
domestic guinea pig(100734232) polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
naked mole-rat(101725588) polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
cow(282312) polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
sheep(100144762) polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Zebrafish(553347) polymerase (RNA) II (DNA directed) polypeptide A
dog(479483) polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
domestic cat(101098500) polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503829 Anti-phospho-POLR2A (pSer1619) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA021563 Anti-POLR2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4200469 Anti-POLR2A antibody produced in rabbit Ig fraction of antiserum human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4502239 Anti-POLR2A antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA053012 Anti-POLR2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
PLA0292 Goat anti-RNA Polymerase II Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunoprecipitation (IP), proximity ligation assay, western blot pricing
SAB4200637 Monoclonal Anti-phospho-RNA polymerase II CTD (pSer2) antibody produced in rat clone 3E7C7, purified from hybridoma cell culture monkey, rat, human, mouse, canine
flow cytometry, immunofluorescence, western blot pricing
SAB4200638 Monoclonal Anti−phospho−RNA polymerase II CTD (pSer5) antibody produced in rat clone 1H4B6, purified from hybridoma cell culture mouse, monkey, canine, rat, human
immunofluorescence, western blot pricing
SAB4200586 Monoclonal Anti-POLR2A antibody produced in mouse ~1.0 mg/mL, clone RPOL-1, purified immunoglobulin human
western blot pricing
SAB1408705 Monoclonal Anti-POLR2A, (N-terminal) antibody produced in mouse clone IF17, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0128 Rabbit anti-Phospho RNA Polymerase II (S2) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse
immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing
PLA0127 Rabbit anti-RNA Polymerase II Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000937 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABE1471 Anti-phospho-DNA-dependent RNA Pol II, subunit B1 (Ser2/5) Antibody ABE1471 is an antibody against phospho-DNA-dependent RNA Pol II for use in Western Blotting. pricing
MABE953 Anti-phospho RNA Pol II (Ser2), clone 3E7C7 Antibody This Anti-phospho RNA Pol II (Ser2) antibody, clone 3E7C7 is validated for use in western blotting, ChIP-seq, ELISA, ICC & ChIP for the detection of phospho RNA Pol II (Ser2). pricing
MABE954 Anti-phospho RNA Pol II (Ser5), clone 1H4B6 Antibody This Anti-phospho RNA Pol II (Ser5) antibody, clone 1H4B6 is validated for use in western blotting, ChIP-seq, ICC, ELISA & ChIP for the detection of phospho RNA Pol II (Ser5). pricing
MABE955 Anti-phospho RNA Pol II (Ser7), clone 3D4A12 Antibody This Anti-phospho RNA Pol II (Ser7) antibody, clone 3D4A12 is validated for use in western blotting, ChIP-seq, ChIP, ICC & ELISA for the detection of phospho RNA Pol II (Ser7). pricing
MABE348 Anti-phospho-RNAPII Antibody (Thr4), clone 1G7 Detect the phospho-RNAPII (Thr4) protein using this Anti-phospho-RNAPII (Thr4), clone 1G7 validated for use in wb, IP, ICC & ChIP. pricing
MABE350 Anti-phospho-RNAPII (Tyr1) Antibody, clone 3D12 Detect the phospho-RNAPII (Tyr1) protein using this Anti-phospho-RNAPII (Tyr1), clone 3D12 validated for use in WB, IP & ChIP. pricing
MABE1793 Anti-POLR2A Antibody, clone 1F5 Anti-POLR2A, clone 1F5, Cat. No. MABE1793, is a highly specific rat monoclonal antibody that targets DNA-directed RNA polymerase II subunit RPB1 and has been tested for use in Immunocytochemistry, Chromatin Immunoprecipitation (ChIP), and Western Blotting. pricing
05-623-AF488 Anti-RNA polymerase II Antibody, clone CTD4H8, AlexaFluor® 488 Conjugate This Anti-RNA polymerase II Antibody, clone CTD4H8, AlexaFluor® 488 Conjugate is validated for use in Immunocytochemistry for the detection of RNA polymerase II. pricing
05-623-AF647 Anti-RNA polymerase II Antibody, clone CTD4H8, AlexaFluor® 647 Conjugate This Anti-RNA polymerase II Antibody, clone CTD4H8, AlexaFluor® 647 Conjugate is validated for use in Immunocytochemistry for the detection of RNA polymerase II. pricing
05-623-Z Anti-RNA polymerase II Antibody, clone CTD4H8, Ascites Free Anti-RNA polymerase II Antibody, clone CTD4H8, Ascites Free is a highly specific mouse monoclonal antibody, that targets RNA Polymerase & has been tested in western blotting, ICC & ChIP-seq. pricing
05-952-I Anti-RNA Polymerase II Antibody, CTD Antibody, clone 8WG16 Anti-RNA Polymerase II, CTD, clone 8WG16, Cat. No. 05-952-I, is a mouse monoclonal antibody that detects DNA-directed RNA polymerase II subunit RPB1 and has been tested for use in Dot Blot, Immunoprecipitation, Inhibition assay, and Western Blotting. pricing
05-952 Anti-RNA Polymerase II Antibody, CTD, clone 8WG16 Use Anti-RNA Polymerase II Antibody, CTD, clone 8WG16 (Mouse Monoclonal Antibody) validated in ChIP, ICC, IP, WB to detect RNA Polymerase II also known as DNA directed RNA polymerase II polypeptide A. pricing
04-1569 Anti-RNA polymerase II subunit B1 Antibody, clone 4F8 Anti-RNA polymerase II subunit B1 Antibody, clone 4F8 is a Rat monoclonal antibody for detection of RNA polymerase II subunit B1 also known as DNA-directed RNA polymerase II A & has been validated in WB, ELISA. pricing
04-1571 Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2) Antibody, clone 3E10 Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2) Antibody, clone 3E10 is a Rat monoclonal antibody for detection of RNA polymerase II subunit B1 (phospho CTD Ser-2) has been validated in WB, ELISA. pricing
04-1571-I Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2), clone 3E10 (rat monoclonal). Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2), clone 3E1 (rat monoclonal) is a highly specific rat monoclonal antibody & that targets RNA Polymerase & has been tested in western blotting. pricing
04-1572 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5) Antibody, clone 3E8 Use Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5) Antibody, clone 3E8 (Rat Monoclonal Antibody) validated in WB, ELISA, ChIP to detect RNA polymerase II subunit B1 (phospho-CTD Ser-5). pricing
04-1572-I Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5) Antibody, clone 3E8 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5) Antibody, clone 3E8 is a highly specific rat monoclonal antibody, that targets RNA Polymerase & has been tested in western blotting & ELISA. pricing
04-1570 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-7) Antibody, clone 4E12 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-7) Antibody, clone 4E12 is a Rat monoclonal antibody for detection of RNA polymerase II subunit B1 (phospho-CTD Ser-7) has been validated in WB, ELISA. pricing
04-1570-I Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-7) Antibody, clone 4E12 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-7) Antibody, clone 4E12 is a highly specific rat monoclonal antibody & that targets RNA Polymerase & has been tested in western blotting. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000937 Rosetta Predictions human pricing
XM_001079162 Rosetta Predictions rat pricing
XM_343922 Rosetta Predictions rat pricing
NM_009089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208920 predicted 637
2 SASI_Hs01_00208921 predicted 2208
3 SASI_Hs01_00208923 predicted 1085
4 SASI_Hs02_00303539 predicted 4390
5 SASI_Hs02_00303540 predicted 4096
6 SASI_Hs01_00208926 predicted 2241
7 SASI_Hs01_00208929 predicted 1666
8 SASI_Hs01_00208927 predicted 2365
9 SASI_Hs02_00303541 predicted 2022
10 SASI_Hs02_00303542 predicted 1382
11 SASI_Hs01_00208922 predicted 2710
12 SASI_Hs01_00208924 predicted 3422
13 SASI_Hs01_00208925 predicted 4790
14 SASI_Hs01_00208928 predicted 4658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363319 predicted 1665
2 SASI_Rn02_00363320 predicted 5553
3 SASI_Rn02_00363321 predicted 5704
4 SASI_Rn02_00363322 predicted 4283
5 SASI_Rn02_00363323 predicted 4008
6 SASI_Rn02_00363324 predicted 2619
7 SASI_Rn02_00363325 predicted 3129
8 SASI_Rn02_00363326 predicted 1139
9 SASI_Rn02_00363327 predicted 1994
10 SASI_Rn02_00363328 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396565 predicted 1663
2 SASI_Rn02_00396566 predicted 5557
3 SASI_Rn02_00396567 predicted 5711
4 SASI_Rn02_00396568 predicted 4291
5 SASI_Rn02_00396569 predicted 4003
6 SASI_Rn02_00396570 predicted 2617
7 SASI_Rn02_00396571 predicted 3123
8 SASI_Rn02_00396572 predicted 1146
9 SASI_Rn02_00396573 predicted 1998
10 SASI_Rn02_00396574 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185189 predicted 1674
2 SASI_Mm02_00315303 predicted 244
3 SASI_Mm01_00185190 predicted 3868
4 SASI_Mm01_00185191 predicted 2206
5 SASI_Mm01_00185192 predicted 3507
6 SASI_Mm02_00315304 predicted 1792
7 SASI_Mm01_00185195 predicted 1582
8 SASI_Mm01_00185196 predicted 3125
9 SASI_Mm01_00185197 predicted 3585
10 SASI_Mm02_00315305 predicted 1196
11 SASI_Mm01_00185193 predicted 2846
12 SASI_Mm01_00185194 predicted 248
13 SASI_Mm01_00185198 predicted 3740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000937
VALIDATED
POLR2A MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-1826s21c1
Sequence:CCGGATCGGCCTGTCATGGGTATTGCTCGAGCAATACCCATGACAGGCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-831s21c1
Sequence:CCGGTGCGGAATGGAAGCACGTTAACTCGAGTTAACGTGCTTCCATTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-2275s21c1
Sequence:CCGGCTCATCGAGGGTCATACTATTCTCGAGAATAGTATGACCCTCGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-3957s21c1
Sequence:CCGGCGACTTGAACTGCATCTTTAACTCGAGTTAAAGATGCAGTTCAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000937.3-6242s21c1
Sequence:CCGGCCAGCTCCGTTGTACATAAATCTCGAGATTTATGTACAACGGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-3605s21c1
Sequence:CCGGTTAAGGAGCTCATCAACATTTCTCGAGAAATGTTGATGAGCTCCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-4109s1c1
Sequence:CCGGCGACTTGAACTGCATCTTTAACTCGAGTTAAAGATGCAGTTCAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-2663s1c1
Sequence:CCGGCCTGTCTGAATACAACAACTTCTCGAGAAGTTGTTGTATTCAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000937.2-2516s1c1
Sequence:CCGGGCAGGACGTAATAGAGGTCATCTCGAGATGACCTCTATTACGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-984s1c1
Sequence:CCGGGCGGAATGGAAGCACGTTAATCTCGAGATTAACGTGCTTCCATTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-1834s1c1
Sequence:CCGGGCTTGAATCTTAGCGTGACAACTCGAGTTGTCACGCTAAGATTCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000937
VALIDATED
POLR2A MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-1826s21c1
Sequence:CCGGATCGGCCTGTCATGGGTATTGCTCGAGCAATACCCATGACAGGCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-831s21c1
Sequence:CCGGTGCGGAATGGAAGCACGTTAACTCGAGTTAACGTGCTTCCATTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-2275s21c1
Sequence:CCGGCTCATCGAGGGTCATACTATTCTCGAGAATAGTATGACCCTCGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-3957s21c1
Sequence:CCGGCGACTTGAACTGCATCTTTAACTCGAGTTAAAGATGCAGTTCAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000937.3-6242s21c1
Sequence:CCGGCCAGCTCCGTTGTACATAAATCTCGAGATTTATGTACAACGGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-3605s21c1
Sequence:CCGGTTAAGGAGCTCATCAACATTTCTCGAGAAATGTTGATGAGCTCCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-4109s1c1
Sequence:CCGGCGACTTGAACTGCATCTTTAACTCGAGTTAAAGATGCAGTTCAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-2663s1c1
Sequence:CCGGCCTGTCTGAATACAACAACTTCTCGAGAAGTTGTTGTATTCAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000937.2-2516s1c1
Sequence:CCGGGCAGGACGTAATAGAGGTCATCTCGAGATGACCTCTATTACGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-984s1c1
Sequence:CCGGGCGGAATGGAAGCACGTTAATCTCGAGATTAACGTGCTTCCATTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-1834s1c1
Sequence:CCGGGCTTGAATCTTAGCGTGACAACTCGAGTTGTCACGCTAAGATTCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000937
VALIDATED
POLR2A MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-1826s21c1
Sequence:CCGGATCGGCCTGTCATGGGTATTGCTCGAGCAATACCCATGACAGGCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-831s21c1
Sequence:CCGGTGCGGAATGGAAGCACGTTAACTCGAGTTAACGTGCTTCCATTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-2275s21c1
Sequence:CCGGCTCATCGAGGGTCATACTATTCTCGAGAATAGTATGACCCTCGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-3957s21c1
Sequence:CCGGCGACTTGAACTGCATCTTTAACTCGAGTTAAAGATGCAGTTCAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000937.3-6242s21c1
Sequence:CCGGCCAGCTCCGTTGTACATAAATCTCGAGATTTATGTACAACGGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000937.3-3605s21c1
Sequence:CCGGTTAAGGAGCTCATCAACATTTCTCGAGAAATGTTGATGAGCTCCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-4109s1c1
Sequence:CCGGCGACTTGAACTGCATCTTTAACTCGAGTTAAAGATGCAGTTCAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-2663s1c1
Sequence:CCGGCCTGTCTGAATACAACAACTTCTCGAGAAGTTGTTGTATTCAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000937.2-2516s1c1
Sequence:CCGGGCAGGACGTAATAGAGGTCATCTCGAGATGACCTCTATTACGTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-984s1c1
Sequence:CCGGGCGGAATGGAAGCACGTTAATCTCGAGATTAACGTGCTTCCATTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000937.2-1834s1c1
Sequence:CCGGGCTTGAATCTTAGCGTGACAACTCGAGTTGTCACGCTAAGATTCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009089
VALIDATED
POLR2A MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009089.2-1250s21c1
Sequence:CCGGAGTACATCATCCGCGATAATGCTCGAGCATTATCGCGGATGATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-3732s21c1
Sequence:CCGGTTGTATCTTCAACGATGATAACTCGAGTTATCATCGTTGAAGATACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-5214s21c1
Sequence:CCGGTACACCCACCAGCCCTAATTACTCGAGTAATTAGGGCTGGTGGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009089.2-1044s21c1
Sequence:CCGGACGGGTTCGAGGGAATCTAATCTCGAGATTAGATTCCCTCGAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-1623s21c1
Sequence:CCGGACTCACGGCAGTACGCAAATTCTCGAGAATTTGCGTACTGCCGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-2158s1c1
Sequence:CCGGGCTCATAACAATGAGCTAGAACTCGAGTTCTAGCTCATTGTTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009089.1-658s1c1
Sequence:CCGGCGAGTGCATGAAATCTTCAAACTCGAGTTTGAAGATTTCATGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-4276s1c1
Sequence:CCGGCCGCTCATGAAATGCTCCTTTCTCGAGAAAGGAGCATTTCATGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-5120s1c1
Sequence:CCGGGCCCTAACTATTCTCCAACTACTCGAGTAGTTGGAGAATAGTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009089.1-2719s1c1
Sequence:CCGGGCTACACTTAAACCTTCTAATCTCGAGATTAGAAGGTTTAAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009089
VALIDATED
POLR2A MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009089.2-1250s21c1
Sequence:CCGGAGTACATCATCCGCGATAATGCTCGAGCATTATCGCGGATGATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-3732s21c1
Sequence:CCGGTTGTATCTTCAACGATGATAACTCGAGTTATCATCGTTGAAGATACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-5214s21c1
Sequence:CCGGTACACCCACCAGCCCTAATTACTCGAGTAATTAGGGCTGGTGGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009089.2-1044s21c1
Sequence:CCGGACGGGTTCGAGGGAATCTAATCTCGAGATTAGATTCCCTCGAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-1623s21c1
Sequence:CCGGACTCACGGCAGTACGCAAATTCTCGAGAATTTGCGTACTGCCGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-2158s1c1
Sequence:CCGGGCTCATAACAATGAGCTAGAACTCGAGTTCTAGCTCATTGTTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009089.1-658s1c1
Sequence:CCGGCGAGTGCATGAAATCTTCAAACTCGAGTTTGAAGATTTCATGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-4276s1c1
Sequence:CCGGCCGCTCATGAAATGCTCCTTTCTCGAGAAAGGAGCATTTCATGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-5120s1c1
Sequence:CCGGGCCCTAACTATTCTCCAACTACTCGAGTAGTTGGAGAATAGTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009089.1-2719s1c1
Sequence:CCGGGCTACACTTAAACCTTCTAATCTCGAGATTAGAAGGTTTAAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009089
VALIDATED
POLR2A MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide A, 220kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009089.2-1250s21c1
Sequence:CCGGAGTACATCATCCGCGATAATGCTCGAGCATTATCGCGGATGATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-3732s21c1
Sequence:CCGGTTGTATCTTCAACGATGATAACTCGAGTTATCATCGTTGAAGATACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-5214s21c1
Sequence:CCGGTACACCCACCAGCCCTAATTACTCGAGTAATTAGGGCTGGTGGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009089.2-1044s21c1
Sequence:CCGGACGGGTTCGAGGGAATCTAATCTCGAGATTAGATTCCCTCGAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009089.2-1623s21c1
Sequence:CCGGACTCACGGCAGTACGCAAATTCTCGAGAATTTGCGTACTGCCGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-2158s1c1
Sequence:CCGGGCTCATAACAATGAGCTAGAACTCGAGTTCTAGCTCATTGTTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009089.1-658s1c1
Sequence:CCGGCGAGTGCATGAAATCTTCAAACTCGAGTTTGAAGATTTCATGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-4276s1c1
Sequence:CCGGCCGCTCATGAAATGCTCCTTTCTCGAGAAAGGAGCATTTCATGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009089.1-5120s1c1
Sequence:CCGGGCCCTAACTATTCTCCAACTACTCGAGTAGTTGGAGAATAGTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009089.1-2719s1c1
Sequence:CCGGGCTACACTTAAACCTTCTAATCTCGAGATTAGAAGGTTTAAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)