EMAIL THIS PAGE TO A FRIEND

POLR2B

polymerase (RNA) II (DNA directed) polypeptide B, 140kDa

49 Gene Product Result for
Synonyms: POL2RB RPB2 hRPB140 hsRPB2
UniProtKB ID: P30876, A8K1A8, Q8IZ61
Gene ID:
Human(5431) Summary: This gene encodes the second largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit, in combination with at least two other polymerase subunits, forms a structure within the polymerase that maintains contact in the active site of the enzyme between the DNA template and the newly synthesized RNA. [provided by RefSeq, Jul 2008]
Mouse(231329) polymerase (RNA) II (DNA directed) polypeptide B
Rat(289561) polymerase (RNA) II (DNA directed) polypeptide B
Zebrafish(100149268) polymerase (RNA) II (DNA directed) polypeptide B
dog(475152) polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
domestic cat(101082819) polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
chicken(422621) polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
cow(538184) polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
sheep(101111368) polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
naked mole-rat(101716957) polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
domestic guinea pig(100731023) polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32456 Anti-POLR2B (AB1) antibody produced in rabbit affinity isolated antibody bovine, mouse, horse, rat, guinea pig, human, dog, rabbit
western blot pricing
AV32457 Anti-POLR2B (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, rat, horse, bovine, human, guinea pig, dog, mouse
western blot pricing
HPA037506 Anti-POLR2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000938 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000938 Rosetta Predictions human pricing
NM_001106002 Rosetta Predictions rat pricing
NM_153798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113896 predicted 3080
2 SASI_Hs01_00113897 predicted 2328
3 SASI_Hs01_00113898 predicted 1430
4 SASI_Hs01_00113899 predicted 1623
5 SASI_Hs01_00113900 predicted 787
6 SASI_Hs02_00303543 predicted 3520
7 SASI_Hs01_00113901 predicted 938
8 SASI_Hs01_00113902 predicted 3237
9 SASI_Hs01_00113903 predicted 2312
10 SASI_Hs01_00113904 predicted 2896
11 SASI_Hs01_00113895 predicted 3470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214662 predicted 1418
2 SASI_Rn02_00214663 predicted 258
3 SASI_Rn02_00214664 predicted 301
4 SASI_Rn02_00214665 predicted 410
5 SASI_Rn02_00214666 predicted 2719
6 SASI_Rn02_00214667 predicted 2627
7 SASI_Rn02_00214668 predicted 3058
8 SASI_Rn02_00214669 predicted 456
9 SASI_Rn02_00214670 predicted 2477
10 SASI_Rn02_00214671 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146171 predicted 869
2 SASI_Mm01_00146172 predicted 290
3 SASI_Mm01_00146174 predicted 402
4 SASI_Mm01_00146175 predicted 2405
5 SASI_Mm01_00146176 predicted 474
6 SASI_Mm01_00146177 predicted 1707
7 SASI_Mm01_00146178 predicted 1235
8 SASI_Mm01_00146179 predicted 914
9 SASI_Mm01_00146180 predicted 452
10 SASI_Mm02_00343534 predicted 1532
11 SASI_Mm01_00146173 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153798
VALIDATED
POLR2B MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-1574s21c1
Sequence:CCGGGCGTCGTCTAAACTCTCCTATCTCGAGATAGGAGAGTTTAGACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-361s1c1
Sequence:CCGGGCCGCCAAGATATTTACTGAACTCGAGTTCAGTAAATATCTTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-1567s1c1
Sequence:CCGGGCGTCGTCTAAACTCTCCTATCTCGAGATAGGAGAGTTTAGACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153798.1-3650s1c1
Sequence:CCGGCCAGAAGTTCATGGTCAGATACTCGAGTATCTGACCATGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-1102s1c1
Sequence:CCGGGCCTGGTGTTACTAAGGAGAACTCGAGTTCTCCTTAGTAACACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153798.1-2438s1c1
Sequence:CCGGCCAGCAGGAATCAACTCAATTCTCGAGAATTGAGTTGATTCCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153798.2-3657s21c1
Sequence:CCGGCCAGAAGTTCATGGTCAGATACTCGAGTATCTGACCATGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-2445s21c1
Sequence:CCGGCCAGCAGGAATCAACTCAATTCTCGAGAATTGAGTTGATTCCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-1109s21c1
Sequence:CCGGGCCTGGTGTTACTAAGGAGAACTCGAGTTCTCCTTAGTAACACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153798
VALIDATED
POLR2B MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-1574s21c1
Sequence:CCGGGCGTCGTCTAAACTCTCCTATCTCGAGATAGGAGAGTTTAGACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-361s1c1
Sequence:CCGGGCCGCCAAGATATTTACTGAACTCGAGTTCAGTAAATATCTTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-1567s1c1
Sequence:CCGGGCGTCGTCTAAACTCTCCTATCTCGAGATAGGAGAGTTTAGACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153798.1-3650s1c1
Sequence:CCGGCCAGAAGTTCATGGTCAGATACTCGAGTATCTGACCATGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-1102s1c1
Sequence:CCGGGCCTGGTGTTACTAAGGAGAACTCGAGTTCTCCTTAGTAACACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153798.1-2438s1c1
Sequence:CCGGCCAGCAGGAATCAACTCAATTCTCGAGAATTGAGTTGATTCCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153798.2-3657s21c1
Sequence:CCGGCCAGAAGTTCATGGTCAGATACTCGAGTATCTGACCATGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-2445s21c1
Sequence:CCGGCCAGCAGGAATCAACTCAATTCTCGAGAATTGAGTTGATTCCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-1109s21c1
Sequence:CCGGGCCTGGTGTTACTAAGGAGAACTCGAGTTCTCCTTAGTAACACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153798
VALIDATED
POLR2B MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-1574s21c1
Sequence:CCGGGCGTCGTCTAAACTCTCCTATCTCGAGATAGGAGAGTTTAGACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-361s1c1
Sequence:CCGGGCCGCCAAGATATTTACTGAACTCGAGTTCAGTAAATATCTTGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-1567s1c1
Sequence:CCGGGCGTCGTCTAAACTCTCCTATCTCGAGATAGGAGAGTTTAGACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153798.1-3650s1c1
Sequence:CCGGCCAGAAGTTCATGGTCAGATACTCGAGTATCTGACCATGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153798.1-1102s1c1
Sequence:CCGGGCCTGGTGTTACTAAGGAGAACTCGAGTTCTCCTTAGTAACACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153798.1-2438s1c1
Sequence:CCGGCCAGCAGGAATCAACTCAATTCTCGAGAATTGAGTTGATTCCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153798.2-3657s21c1
Sequence:CCGGCCAGAAGTTCATGGTCAGATACTCGAGTATCTGACCATGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-2445s21c1
Sequence:CCGGCCAGCAGGAATCAACTCAATTCTCGAGAATTGAGTTGATTCCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153798.2-1109s21c1
Sequence:CCGGGCCTGGTGTTACTAAGGAGAACTCGAGTTCTCCTTAGTAACACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000938
VALIDATED
POLR2B MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-287s1c1
Sequence:CCGGCCACGATATTTGCTGAAGTTTCTCGAGAAACTTCAGCAAATATCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-2966s1c1
Sequence:CCGGCGTATGACTATTGGTCACTTACTCGAGTAAGTGACCAATAGTCATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-3475s1c1
Sequence:CCGGCCAGATTTCTTTGGTGCGAATCTCGAGATTCGCACCAAAGAAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000938.1-1024s1c1
Sequence:CCGGGCCTGGTGTTACTAAAGAGAACTCGAGTTCTCTTTAGTAACACCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-811s21c1
Sequence:CCGGTGTGGCAACTCTACCATATATCTCGAGATATATGGTAGAGTTGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-3578s21c1
Sequence:CCGGAGGAGTCAACAAGATAATTAACTCGAGTTAATTATCTTGTTGACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-1480s21c1
Sequence:CCGGTTCTCACCTGCGTCGTTTAAACTCGAGTTTAAACGACGCAGGTGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-398s21c1
Sequence:CCGGACGTATTCTGCTCCGCTTTATCTCGAGATAAAGCGGAGCAGAATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-728s21c1
Sequence:CCGGTCCCGACCCACCAGTACTATACTCGAGTATAGTACTGGTGGGTCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-1619s21c1
Sequence:CCGGTTAGCCTTGATGGCGTATATTCTCGAGAATATACGCCATCAAGGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000938
VALIDATED
POLR2B MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-287s1c1
Sequence:CCGGCCACGATATTTGCTGAAGTTTCTCGAGAAACTTCAGCAAATATCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-2966s1c1
Sequence:CCGGCGTATGACTATTGGTCACTTACTCGAGTAAGTGACCAATAGTCATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-3475s1c1
Sequence:CCGGCCAGATTTCTTTGGTGCGAATCTCGAGATTCGCACCAAAGAAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000938.1-1024s1c1
Sequence:CCGGGCCTGGTGTTACTAAAGAGAACTCGAGTTCTCTTTAGTAACACCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-811s21c1
Sequence:CCGGTGTGGCAACTCTACCATATATCTCGAGATATATGGTAGAGTTGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-3578s21c1
Sequence:CCGGAGGAGTCAACAAGATAATTAACTCGAGTTAATTATCTTGTTGACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-1480s21c1
Sequence:CCGGTTCTCACCTGCGTCGTTTAAACTCGAGTTTAAACGACGCAGGTGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-398s21c1
Sequence:CCGGACGTATTCTGCTCCGCTTTATCTCGAGATAAAGCGGAGCAGAATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-728s21c1
Sequence:CCGGTCCCGACCCACCAGTACTATACTCGAGTATAGTACTGGTGGGTCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-1619s21c1
Sequence:CCGGTTAGCCTTGATGGCGTATATTCTCGAGAATATACGCCATCAAGGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000938
VALIDATED
POLR2B MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-287s1c1
Sequence:CCGGCCACGATATTTGCTGAAGTTTCTCGAGAAACTTCAGCAAATATCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-2966s1c1
Sequence:CCGGCGTATGACTATTGGTCACTTACTCGAGTAAGTGACCAATAGTCATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000938.1-3475s1c1
Sequence:CCGGCCAGATTTCTTTGGTGCGAATCTCGAGATTCGCACCAAAGAAATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000938.1-1024s1c1
Sequence:CCGGGCCTGGTGTTACTAAAGAGAACTCGAGTTCTCTTTAGTAACACCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-811s21c1
Sequence:CCGGTGTGGCAACTCTACCATATATCTCGAGATATATGGTAGAGTTGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-3578s21c1
Sequence:CCGGAGGAGTCAACAAGATAATTAACTCGAGTTAATTATCTTGTTGACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-1480s21c1
Sequence:CCGGTTCTCACCTGCGTCGTTTAAACTCGAGTTTAAACGACGCAGGTGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-398s21c1
Sequence:CCGGACGTATTCTGCTCCGCTTTATCTCGAGATAAAGCGGAGCAGAATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-728s21c1
Sequence:CCGGTCCCGACCCACCAGTACTATACTCGAGTATAGTACTGGTGGGTCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000938.1-1619s21c1
Sequence:CCGGTTAGCCTTGATGGCGTATATTCTCGAGAATATACGCCATCAAGGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)