EMAIL THIS PAGE TO A FRIEND

POLR2D

polymerase (RNA) II (DNA directed) polypeptide D

94 Gene Product Result for
Synonyms: HSRBP4 HSRPB4 RBP4 RPB16
UniProtKB ID: O15514, Q52LT4
Gene ID:
Human(5433) Summary: This gene encodes the fourth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit is associated with the polymerase under suboptimal growth conditions and may have a stress protective role. A sequence for a ribosomal pseudogene is contained within the 3' untranslated region of the transcript from this gene. [provided by RefSeq, Jul 2008]
Mouse(69241) polymerase (RNA) II (DNA directed) polypeptide D
Rat(364834) polymerase (RNA) II (DNA directed) polypeptide D
Zebrafish(436588) polymerase (RNA) II (DNA directed) polypeptide D
domestic cat(101092702) polymerase (RNA) II (DNA directed) polypeptide D
dog(483863) polymerase (RNA) II (DNA directed) polypeptide D
chicken(424754) polymerase (RNA) II (DNA directed) polypeptide D
cow(617422) polymerase (RNA) II (DNA directed) polypeptide D
sheep(101107845) polymerase (RNA) II (DNA directed) polypeptide D
naked mole-rat(101703872) polymerase (RNA) II (DNA directed) polypeptide D
domestic guinea pig(100719830) polymerase (RNA) II (DNA directed) polypeptide D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004805 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048951 MISSION® esiRNA esiRNA human POLR2D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004805 Rosetta Predictions human pricing
NM_001108886 Rosetta Predictions rat pricing
NM_027002 Rosetta Predictions mouse pricing
NM_027101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132464 predicted 234
2 SASI_Hs01_00132465 predicted 264
3 SASI_Hs01_00132466 predicted 311
4 SASI_Hs01_00132467 predicted 321
5 SASI_Hs01_00132468 predicted 436
6 SASI_Hs02_00338349 predicted 248
7 SASI_Hs01_00132469 predicted 436
8 SASI_Hs01_00132470 predicted 270
9 SASI_Hs01_00132471 predicted 600
10 SASI_Hs01_00132472 predicted 550
11 SASI_Hs01_00132473 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243055 predicted 604
2 SASI_Rn02_00243056 predicted 321
3 SASI_Rn02_00243057 predicted 335
4 SASI_Rn02_00243058 predicted 557
5 SASI_Rn02_00243059 predicted 489
6 SASI_Rn02_00243060 predicted 488
7 SASI_Rn02_00243061 predicted 570
8 SASI_Rn02_00243062 predicted 551
9 SASI_Rn02_00243063 predicted 552
10 SASI_Rn02_00243064 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107622 predicted 444
2 SASI_Mm02_00331370 predicted 704
3 SASI_Mm01_00107624 predicted 554
4 SASI_Mm02_00331371 predicted 532
5 SASI_Mm01_00107625 predicted 505
6 SASI_Mm01_00107626 predicted 692
7 SASI_Mm02_00331372 predicted 716
8 SASI_Mm01_00107627 predicted 304
9 SASI_Mm01_00107628 predicted 570
10 SASI_Mm01_00107629 predicted 425
11 SASI_Mm01_00107621 predicted 712
12 SASI_Mm01_00107623 predicted 719
13 SASI_Mm01_00107630 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079689 predicted 435
2 SASI_Mm01_00079690 predicted 688
3 SASI_Mm01_00079691 predicted 543
4 SASI_Mm02_00331540 predicted 512
5 SASI_Mm01_00079692 predicted 491
6 SASI_Mm01_00079694 predicted 680
7 SASI_Mm01_00079695 predicted 693
8 SASI_Mm01_00079696 predicted 287
9 SASI_Mm01_00079697 predicted 558
10 SASI_Mm01_00079698 predicted 412
11 SASI_Mm01_00079693 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004805
VALIDATED
POLR2D MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-235s1c1
Sequence:CCGGGCCCGTTTCAGTCGTTTCAAACTCGAGTTTGAAACGACTGAAACGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-280s1c1
Sequence:CCGGCGTAGCTTGCTACTCCAGAAACTCGAGTTTCTGGAGTAGCAAGCTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004805.2-411s1c1
Sequence:CCGGGCAGCAGATTCTTGATGATATCTCGAGATATCATCAAGAATCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-87s1c1
Sequence:CCGGGCTCATCTTTCCTAAAGAGTTCTCGAGAACTCTTTAGGAAAGATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004805.2-198s1c1
Sequence:CCGGGCTCTCAGAAGTCTTCATGAACTCGAGTTCATGAAGACTTCTGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-305s21c1
Sequence:CCGGCGTAGCTTGCTACTCCAGAAACTCGAGTTTCTGGAGTAGCAAGCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004805.3-112s21c1
Sequence:CCGGGCTCATCTTTCCTAAAGAGTTCTCGAGAACTCTTTAGGAAAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-260s21c1
Sequence:CCGGGCCCGTTTCAGTCGTTTCAAACTCGAGTTTGAAACGACTGAAACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-223s21c1
Sequence:CCGGGCTCTCAGAAGTCTTCATGAACTCGAGTTCATGAAGACTTCTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004805
VALIDATED
POLR2D MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-235s1c1
Sequence:CCGGGCCCGTTTCAGTCGTTTCAAACTCGAGTTTGAAACGACTGAAACGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-280s1c1
Sequence:CCGGCGTAGCTTGCTACTCCAGAAACTCGAGTTTCTGGAGTAGCAAGCTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004805.2-411s1c1
Sequence:CCGGGCAGCAGATTCTTGATGATATCTCGAGATATCATCAAGAATCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-87s1c1
Sequence:CCGGGCTCATCTTTCCTAAAGAGTTCTCGAGAACTCTTTAGGAAAGATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004805.2-198s1c1
Sequence:CCGGGCTCTCAGAAGTCTTCATGAACTCGAGTTCATGAAGACTTCTGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-305s21c1
Sequence:CCGGCGTAGCTTGCTACTCCAGAAACTCGAGTTTCTGGAGTAGCAAGCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004805.3-112s21c1
Sequence:CCGGGCTCATCTTTCCTAAAGAGTTCTCGAGAACTCTTTAGGAAAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-260s21c1
Sequence:CCGGGCCCGTTTCAGTCGTTTCAAACTCGAGTTTGAAACGACTGAAACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-223s21c1
Sequence:CCGGGCTCTCAGAAGTCTTCATGAACTCGAGTTCATGAAGACTTCTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004805
VALIDATED
POLR2D MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-235s1c1
Sequence:CCGGGCCCGTTTCAGTCGTTTCAAACTCGAGTTTGAAACGACTGAAACGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-280s1c1
Sequence:CCGGCGTAGCTTGCTACTCCAGAAACTCGAGTTTCTGGAGTAGCAAGCTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004805.2-411s1c1
Sequence:CCGGGCAGCAGATTCTTGATGATATCTCGAGATATCATCAAGAATCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004805.2-87s1c1
Sequence:CCGGGCTCATCTTTCCTAAAGAGTTCTCGAGAACTCTTTAGGAAAGATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004805.2-198s1c1
Sequence:CCGGGCTCTCAGAAGTCTTCATGAACTCGAGTTCATGAAGACTTCTGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-305s21c1
Sequence:CCGGCGTAGCTTGCTACTCCAGAAACTCGAGTTTCTGGAGTAGCAAGCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004805.3-112s21c1
Sequence:CCGGGCTCATCTTTCCTAAAGAGTTCTCGAGAACTCTTTAGGAAAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-260s21c1
Sequence:CCGGGCCCGTTTCAGTCGTTTCAAACTCGAGTTTGAAACGACTGAAACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004805.3-223s21c1
Sequence:CCGGGCTCTCAGAAGTCTTCATGAACTCGAGTTCATGAAGACTTCTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027101
POLR2D MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-286s1c1
Sequence:CCGGTGGCCTGTTTAGCCAATCTTTCTCGAGAAAGATTGGCTAAACAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027101.1-774s1c1
Sequence:CCGGCCTGAACTGCTGAGGTAGAATCTCGAGATTCTACCTCAGCAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-165s1c1
Sequence:CCGGCTGTCGGAGGTCTTCATGAAACTCGAGTTTCATGAAGACCTCCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-312s1c1
Sequence:CCGGGAGACTGCTGAAGAGTCCAAACTCGAGTTTGGACTCTTCAGCAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-386s1c1
Sequence:CCGGTCTCGATGACATCCAGACGAACTCGAGTTCGTCTGGATGTCATCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027101.2-774s21c1
Sequence:CCGGCCTGAACTGCTGAGGTAGAATCTCGAGATTCTACCTCAGCAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-165s21c1
Sequence:CCGGCTGTCGGAGGTCTTCATGAAACTCGAGTTTCATGAAGACCTCCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-386s21c1
Sequence:CCGGTCTCGATGACATCCAGACGAACTCGAGTTCGTCTGGATGTCATCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-312s21c1
Sequence:CCGGGAGACTGCTGAAGAGTCCAAACTCGAGTTTGGACTCTTCAGCAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027101
POLR2D MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-286s1c1
Sequence:CCGGTGGCCTGTTTAGCCAATCTTTCTCGAGAAAGATTGGCTAAACAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027101.1-774s1c1
Sequence:CCGGCCTGAACTGCTGAGGTAGAATCTCGAGATTCTACCTCAGCAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-165s1c1
Sequence:CCGGCTGTCGGAGGTCTTCATGAAACTCGAGTTTCATGAAGACCTCCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-312s1c1
Sequence:CCGGGAGACTGCTGAAGAGTCCAAACTCGAGTTTGGACTCTTCAGCAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-386s1c1
Sequence:CCGGTCTCGATGACATCCAGACGAACTCGAGTTCGTCTGGATGTCATCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027101.2-774s21c1
Sequence:CCGGCCTGAACTGCTGAGGTAGAATCTCGAGATTCTACCTCAGCAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-165s21c1
Sequence:CCGGCTGTCGGAGGTCTTCATGAAACTCGAGTTTCATGAAGACCTCCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-386s21c1
Sequence:CCGGTCTCGATGACATCCAGACGAACTCGAGTTCGTCTGGATGTCATCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-312s21c1
Sequence:CCGGGAGACTGCTGAAGAGTCCAAACTCGAGTTTGGACTCTTCAGCAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027101
POLR2D MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-286s1c1
Sequence:CCGGTGGCCTGTTTAGCCAATCTTTCTCGAGAAAGATTGGCTAAACAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027101.1-774s1c1
Sequence:CCGGCCTGAACTGCTGAGGTAGAATCTCGAGATTCTACCTCAGCAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-165s1c1
Sequence:CCGGCTGTCGGAGGTCTTCATGAAACTCGAGTTTCATGAAGACCTCCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-312s1c1
Sequence:CCGGGAGACTGCTGAAGAGTCCAAACTCGAGTTTGGACTCTTCAGCAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027101.1-386s1c1
Sequence:CCGGTCTCGATGACATCCAGACGAACTCGAGTTCGTCTGGATGTCATCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027101.2-774s21c1
Sequence:CCGGCCTGAACTGCTGAGGTAGAATCTCGAGATTCTACCTCAGCAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-165s21c1
Sequence:CCGGCTGTCGGAGGTCTTCATGAAACTCGAGTTTCATGAAGACCTCCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-386s21c1
Sequence:CCGGTCTCGATGACATCCAGACGAACTCGAGTTCGTCTGGATGTCATCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027101.2-312s21c1
Sequence:CCGGGAGACTGCTGAAGAGTCCAAACTCGAGTTTGGACTCTTCAGCAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)