EMAIL THIS PAGE TO A FRIEND

POLR2E

polymerase (RNA) II (DNA directed) polypeptide E, 25kDa

72 Gene Product Result for
Synonyms: RPABC1 RPB5 XAP4 hRPB25 hsRPB5
UniProtKB ID: P19388, B2R6L4, D6W5Y1, O43380, Q6PIH5, Q9BT06
Gene ID:
Human(5434) Summary: This gene encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over the other polymerase subunits. An interaction between this subunit and a hepatitis virus transactivating protein has been demonstrated, suggesting that interaction between transcriptional activators and the polymerase can occur through this subunit. A pseudogene is located on chromosome 11. [provided by RefSeq, Jul 2008]
Mouse(66420) polymerase (RNA) II (DNA directed) polypeptide E
Rat(690966) polymerase (RNA) II (DNA directed) polypeptide E
domestic guinea pig(100729846) polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
naked mole-rat(101709249) polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
cow(512971) polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
sheep(101116826) polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
chicken(420103) polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
dog(611859) polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
domestic cat(101095720) polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002695 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002695 Rosetta Predictions human pricing
NM_001109614 Rosetta Predictions rat pricing
NM_025554 Rosetta Predictions mouse pricing
XM_282920 Rosetta Predictions mouse pricing
XM_900333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216524 predicted 414
2 SASI_Hs01_00216526 predicted 318
3 SASI_Hs02_00334265 predicted 1134
4 SASI_Hs01_00216527 predicted 551
5 SASI_Hs01_00216528 predicted 902
6 SASI_Hs02_00334266 predicted 276
7 SASI_Hs02_00334267 predicted 396
8 SASI_Hs02_00334268 predicted 1187
9 SASI_Hs01_00216523 predicted 537
10 SASI_Hs01_00216525 predicted 555
11 SASI_Hs01_00216529 predicted 863
12 SASI_Hs01_00216530 predicted 611
13 SASI_Hs01_00216531 predicted 276
14 SASI_Hs01_00216532 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250102 predicted 540
2 SASI_Rn02_00250103 predicted 396
3 SASI_Rn02_00250104 predicted 415
4 SASI_Rn02_00250105 predicted 442
5 SASI_Rn02_00250106 predicted 556
6 SASI_Rn02_00250107 predicted 663
7 SASI_Rn02_00250108 predicted 664
8 SASI_Rn02_00250109 predicted 611
9 SASI_Rn02_00250110 predicted 392
10 SASI_Rn02_00250111 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328499 predicted 385
2 SASI_Mm02_00328500 predicted 448
3 SASI_Mm02_00328501 predicted 486
4 SASI_Mm02_00328502 predicted 219
5 SASI_Mm02_00328503 predicted 282
6 SASI_Mm02_00328504 predicted 267
7 SASI_Mm02_00328505 predicted 354
8 SASI_Mm02_00328506 predicted 682
9 SASI_Mm02_00328507 predicted 418
10 SASI_Mm02_00328508 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_282920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258232 predicted 468
2 SASI_Mm01_00258233 predicted 344
3 SASI_Mm01_00258234 predicted 401
4 SASI_Mm01_00258235 predicted 401
5 SASI_Mm01_00258236 predicted 305
6 SASI_Mm01_00258237 predicted 360
7 SASI_Mm01_00258238 predicted 353
8 SASI_Mm01_00258239 predicted 445
9 SASI_Mm01_00258240 predicted 246
10 SASI_Mm01_00258241 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263559 predicted 397
2 SASI_Mm01_00263560 predicted 520
3 SASI_Mm01_00263561 predicted 675
4 SASI_Mm01_00263562 predicted 594
5 SASI_Mm01_00263563 predicted 393
6 SASI_Mm01_00263564 predicted 153
7 SASI_Mm01_00263565 predicted 201
8 SASI_Mm01_00263566 predicted 531
9 SASI_Mm01_00263567 predicted 392
10 SASI_Mm01_00263568 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002695
VALIDATED
POLR2E MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-448s21c1
Sequence:CCGGAGTACATCCTGGAGCAGTTTCCTCGAGGAAACTGCTCCAGGATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-284s21c1
Sequence:CCGGCGACCAGATGTTTGTGTTCTTCTCGAGAAGAACACAAACATCTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-1132s21c1
Sequence:CCGGCCTCGGCTCTTTACTCCATTCCTCGAGGAATGGAGTAAAGAGCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002695.2-505s1c1
Sequence:CCGGCCGATATAAGCTCCGAGAGAACTCGAGTTCTCTCGGAGCTTATATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-80s1c1
Sequence:CCGGCTGTGCCACGACCGTGGCTATCTCGAGATAGCCACGGTCGTGGCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-229s1c1
Sequence:CCGGCGACCAGATGTTTGTGTTCTTCTCGAGAAGAACACAAACATCTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-134s1c1
Sequence:CCGGGAGGAGTTCAAAGCCCAATTTCTCGAGAAATTGGGCTTTGAACTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-189s21c1
Sequence:CCGGGAGGAGTTCAAAGCCCAATTTCTCGAGAAATTGGGCTTTGAACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002695
VALIDATED
POLR2E MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-448s21c1
Sequence:CCGGAGTACATCCTGGAGCAGTTTCCTCGAGGAAACTGCTCCAGGATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-284s21c1
Sequence:CCGGCGACCAGATGTTTGTGTTCTTCTCGAGAAGAACACAAACATCTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-1132s21c1
Sequence:CCGGCCTCGGCTCTTTACTCCATTCCTCGAGGAATGGAGTAAAGAGCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002695.2-505s1c1
Sequence:CCGGCCGATATAAGCTCCGAGAGAACTCGAGTTCTCTCGGAGCTTATATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-80s1c1
Sequence:CCGGCTGTGCCACGACCGTGGCTATCTCGAGATAGCCACGGTCGTGGCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-229s1c1
Sequence:CCGGCGACCAGATGTTTGTGTTCTTCTCGAGAAGAACACAAACATCTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-134s1c1
Sequence:CCGGGAGGAGTTCAAAGCCCAATTTCTCGAGAAATTGGGCTTTGAACTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-189s21c1
Sequence:CCGGGAGGAGTTCAAAGCCCAATTTCTCGAGAAATTGGGCTTTGAACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002695
VALIDATED
POLR2E MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-448s21c1
Sequence:CCGGAGTACATCCTGGAGCAGTTTCCTCGAGGAAACTGCTCCAGGATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-284s21c1
Sequence:CCGGCGACCAGATGTTTGTGTTCTTCTCGAGAAGAACACAAACATCTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-1132s21c1
Sequence:CCGGCCTCGGCTCTTTACTCCATTCCTCGAGGAATGGAGTAAAGAGCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002695.2-505s1c1
Sequence:CCGGCCGATATAAGCTCCGAGAGAACTCGAGTTCTCTCGGAGCTTATATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-80s1c1
Sequence:CCGGCTGTGCCACGACCGTGGCTATCTCGAGATAGCCACGGTCGTGGCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-229s1c1
Sequence:CCGGCGACCAGATGTTTGTGTTCTTCTCGAGAAGAACACAAACATCTGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002695.2-134s1c1
Sequence:CCGGGAGGAGTTCAAAGCCCAATTTCTCGAGAAATTGGGCTTTGAACTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002695.3-189s21c1
Sequence:CCGGGAGGAGTTCAAAGCCCAATTTCTCGAGAAATTGGGCTTTGAACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025554
VALIDATED
POLR2E MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-828s21c1
Sequence:CCGGACAGCCTGTGGGTCATAACTGCTCGAGCAGTTATGACCCACAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-269s21c1
Sequence:CCGGCATCAAGACCATCAAGGTATACTCGAGTATACCTTGATGGTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-459s21c1
Sequence:CCGGGAGCACGTGGTCATGACAAAGCTCGAGCTTTGTCATGACCACGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-391s21c1
Sequence:CCGGAGTATGTGCTGGAACAGTTTCCTCGAGGAAACTGTTCCAGCACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-491s21c1
Sequence:CCGGTGAACTGCTGGCTCGATACAACTCGAGTTGTATCGAGCCAGCAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025554
VALIDATED
POLR2E MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-828s21c1
Sequence:CCGGACAGCCTGTGGGTCATAACTGCTCGAGCAGTTATGACCCACAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-269s21c1
Sequence:CCGGCATCAAGACCATCAAGGTATACTCGAGTATACCTTGATGGTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-459s21c1
Sequence:CCGGGAGCACGTGGTCATGACAAAGCTCGAGCTTTGTCATGACCACGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-391s21c1
Sequence:CCGGAGTATGTGCTGGAACAGTTTCCTCGAGGAAACTGTTCCAGCACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-491s21c1
Sequence:CCGGTGAACTGCTGGCTCGATACAACTCGAGTTGTATCGAGCCAGCAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025554
VALIDATED
POLR2E MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-828s21c1
Sequence:CCGGACAGCCTGTGGGTCATAACTGCTCGAGCAGTTATGACCCACAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-269s21c1
Sequence:CCGGCATCAAGACCATCAAGGTATACTCGAGTATACCTTGATGGTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-459s21c1
Sequence:CCGGGAGCACGTGGTCATGACAAAGCTCGAGCTTTGTCATGACCACGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-391s21c1
Sequence:CCGGAGTATGTGCTGGAACAGTTTCCTCGAGGAAACTGTTCCAGCACATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025554.2-491s21c1
Sequence:CCGGTGAACTGCTGGCTCGATACAACTCGAGTTGTATCGAGCCAGCAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)