EMAIL THIS PAGE TO A FRIEND

POLR2H

polymerase (RNA) II (DNA directed) polypeptide H

120 Gene Product Result for
Synonyms: RPABC3 RPB17 RPB8
UniProtKB ID: P52434, P53802, Q969R0
Gene ID:
Human(5437) Summary: The three eukaryotic RNA polymerases are complex multisubunit enzymes that play a central role in the transcription of nuclear genes. This gene encodes an essential and highly conserved subunit of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(245841) polymerase (RNA) II (DNA directed) polypeptide H
Rat(498109) polymerase (RNA) II (DNA directed) polypeptide H
chicken(424954) polymerase (RNA) II (DNA directed) polypeptide H
domestic cat(101084389) polymerase (RNA) II (DNA directed) polypeptide H
dog(478656) polymerase (RNA) II (DNA directed) polypeptide H
cow(505599) polymerase (RNA) II (DNA directed) polypeptide H
sheep(101119867) polymerase (RNA) II (DNA directed) polypeptide H
naked mole-rat(101706663) polymerase (RNA) II (DNA directed) polypeptide H
domestic guinea pig(100726327) polymerase (RNA) II (DNA directed) polypeptide H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006232 Rosetta Predictions human pricing
NM_001134789 Rosetta Predictions rat pricing
NM_145632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237885 predicted 231
2 SASI_Hs02_00341147 predicted 225
3 SASI_Hs01_00237886 predicted 350
4 SASI_Hs01_00237887 predicted 471
5 SASI_Hs01_00237889 predicted 239
6 SASI_Hs01_00237891 predicted 564
7 SASI_Hs01_00237892 predicted 580
8 SASI_Hs02_00341148 predicted 336
9 SASI_Hs02_00341149 predicted 242
10 SASI_Hs01_00237893 predicted 481
11 SASI_Hs01_00237888 predicted 351
12 SASI_Hs01_00237890 predicted 335
13 SASI_Hs01_00237894 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258514 predicted 263
2 SASI_Rn02_00258515 predicted 241
3 SASI_Rn02_00258516 predicted 288
4 SASI_Rn02_00258517 predicted 280
5 SASI_Rn02_00258518 predicted 253
6 SASI_Rn02_00258519 predicted 470
7 SASI_Rn02_00258520 predicted 203
8 SASI_Rn02_00258521 predicted 411
9 SASI_Rn02_00258522 predicted 510
10 SASI_Rn02_00258523 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341215 predicted 538
2 SASI_Mm02_00341216 predicted 538
3 SASI_Mm02_00341217 predicted 703
4 SASI_Mm01_00170834 predicted 479
5 SASI_Mm01_00170835 predicted 307
6 SASI_Mm01_00170836 predicted 258
7 SASI_Mm01_00170837 predicted 362
8 SASI_Mm01_00170838 predicted 501
9 SASI_Mm01_00170839 predicted 362
10 SASI_Mm01_00170840 predicted 260
11 SASI_Mm01_00170841 predicted 353
12 SASI_Mm01_00170842 predicted 240
13 SASI_Mm01_00170843 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006232
VALIDATED
POLR2H MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide H
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006232.2-341s1c1
Sequence:CCGGCTGACCAGTTTGAGTATGTAACTCGAGTTACATACTCAAACTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006232.2-516s1c1
Sequence:CCGGCCTGATGAAGAAGCTAGCCTTCTCGAGAAGGCTAGCTTCTTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006232.2-268s1c1
Sequence:CCGGGCTAGTACCTTGTATGAAGATCTCGAGATCTTCATACAAGGTACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006232.2-171s1c1
Sequence:CCGGGCATTGTGAGAGTGAATCTTTCTCGAGAAAGATTCACTCTCACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006232.2-649s21c1
Sequence:CCGGTCCACCGTGGCGGCATCTTTACTCGAGTAAAGATGCCGCCACGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-166s21c1
Sequence:CCGGCGACTGCATTGTGAGAGTGAACTCGAGTTCACTCTCACAATGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006232.2-166s1c1
Sequence:CCGGCGACTGCATTGTGAGAGTGAACTCGAGTTCACTCTCACAATGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-268s21c1
Sequence:CCGGGCTAGTACCTTGTATGAAGATCTCGAGATCTTCATACAAGGTACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-291s21c1
Sequence:CCGGTACCCTGGATGATGGTGAATACTCGAGTATTCACCATCATCCAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006232
VALIDATED
POLR2H MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide H
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006232.2-341s1c1
Sequence:CCGGCTGACCAGTTTGAGTATGTAACTCGAGTTACATACTCAAACTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006232.2-516s1c1
Sequence:CCGGCCTGATGAAGAAGCTAGCCTTCTCGAGAAGGCTAGCTTCTTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006232.2-268s1c1
Sequence:CCGGGCTAGTACCTTGTATGAAGATCTCGAGATCTTCATACAAGGTACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006232.2-171s1c1
Sequence:CCGGGCATTGTGAGAGTGAATCTTTCTCGAGAAAGATTCACTCTCACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006232.2-649s21c1
Sequence:CCGGTCCACCGTGGCGGCATCTTTACTCGAGTAAAGATGCCGCCACGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-166s21c1
Sequence:CCGGCGACTGCATTGTGAGAGTGAACTCGAGTTCACTCTCACAATGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006232.2-166s1c1
Sequence:CCGGCGACTGCATTGTGAGAGTGAACTCGAGTTCACTCTCACAATGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-268s21c1
Sequence:CCGGGCTAGTACCTTGTATGAAGATCTCGAGATCTTCATACAAGGTACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-291s21c1
Sequence:CCGGTACCCTGGATGATGGTGAATACTCGAGTATTCACCATCATCCAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006232
VALIDATED
POLR2H MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide H
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006232.2-341s1c1
Sequence:CCGGCTGACCAGTTTGAGTATGTAACTCGAGTTACATACTCAAACTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006232.2-516s1c1
Sequence:CCGGCCTGATGAAGAAGCTAGCCTTCTCGAGAAGGCTAGCTTCTTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006232.2-268s1c1
Sequence:CCGGGCTAGTACCTTGTATGAAGATCTCGAGATCTTCATACAAGGTACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006232.2-171s1c1
Sequence:CCGGGCATTGTGAGAGTGAATCTTTCTCGAGAAAGATTCACTCTCACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006232.2-649s21c1
Sequence:CCGGTCCACCGTGGCGGCATCTTTACTCGAGTAAAGATGCCGCCACGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-166s21c1
Sequence:CCGGCGACTGCATTGTGAGAGTGAACTCGAGTTCACTCTCACAATGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006232.2-166s1c1
Sequence:CCGGCGACTGCATTGTGAGAGTGAACTCGAGTTCACTCTCACAATGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-268s21c1
Sequence:CCGGGCTAGTACCTTGTATGAAGATCTCGAGATCTTCATACAAGGTACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006232.2-291s21c1
Sequence:CCGGTACCCTGGATGATGGTGAATACTCGAGTATTCACCATCATCCAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145632
VALIDATED
POLR2H MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide H
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145632.1-619s1c1
Sequence:CCGGCTGTCGGTGTTAGCCTGTAAACTCGAGTTTACAGGCTAACACCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145632.1-481s1c1
Sequence:CCGGGCCAACAACCTGCATGGATTTCTCGAGAAATCCATGCAGGTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-152s1c1
Sequence:CCGGGCAAGAAATTTGACCGAGTATCTCGAGATACTCGGTCAAATTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-210s1c1
Sequence:CCGGCCTCATCTTAGATGTAAACATCTCGAGATGTTTACATCTAAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-186s1c1
Sequence:CCGGTGAGAGTGAATCTTTCAAGATCTCGAGATCTTGAAAGATTCACTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-186s21c1
Sequence:CCGGTGAGAGTGAATCTTTCAAGATCTCGAGATCTTGAAAGATTCACTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-210s21c1
Sequence:CCGGCCTCATCTTAGATGTAAACATCTCGAGATGTTTACATCTAAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-152s21c1
Sequence:CCGGGCAAGAAATTTGACCGAGTATCTCGAGATACTCGGTCAAATTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145632.2-619s21c1
Sequence:CCGGCTGTCGGTGTTAGCCTGTAAACTCGAGTTTACAGGCTAACACCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-481s21c1
Sequence:CCGGGCCAACAACCTGCATGGATTTCTCGAGAAATCCATGCAGGTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145632
VALIDATED
POLR2H MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide H
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145632.1-619s1c1
Sequence:CCGGCTGTCGGTGTTAGCCTGTAAACTCGAGTTTACAGGCTAACACCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145632.1-481s1c1
Sequence:CCGGGCCAACAACCTGCATGGATTTCTCGAGAAATCCATGCAGGTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-152s1c1
Sequence:CCGGGCAAGAAATTTGACCGAGTATCTCGAGATACTCGGTCAAATTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-210s1c1
Sequence:CCGGCCTCATCTTAGATGTAAACATCTCGAGATGTTTACATCTAAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-186s1c1
Sequence:CCGGTGAGAGTGAATCTTTCAAGATCTCGAGATCTTGAAAGATTCACTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-186s21c1
Sequence:CCGGTGAGAGTGAATCTTTCAAGATCTCGAGATCTTGAAAGATTCACTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-210s21c1
Sequence:CCGGCCTCATCTTAGATGTAAACATCTCGAGATGTTTACATCTAAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-152s21c1
Sequence:CCGGGCAAGAAATTTGACCGAGTATCTCGAGATACTCGGTCAAATTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145632.2-619s21c1
Sequence:CCGGCTGTCGGTGTTAGCCTGTAAACTCGAGTTTACAGGCTAACACCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-481s21c1
Sequence:CCGGGCCAACAACCTGCATGGATTTCTCGAGAAATCCATGCAGGTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145632
VALIDATED
POLR2H MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide H
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145632.1-619s1c1
Sequence:CCGGCTGTCGGTGTTAGCCTGTAAACTCGAGTTTACAGGCTAACACCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145632.1-481s1c1
Sequence:CCGGGCCAACAACCTGCATGGATTTCTCGAGAAATCCATGCAGGTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-152s1c1
Sequence:CCGGGCAAGAAATTTGACCGAGTATCTCGAGATACTCGGTCAAATTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-210s1c1
Sequence:CCGGCCTCATCTTAGATGTAAACATCTCGAGATGTTTACATCTAAGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145632.1-186s1c1
Sequence:CCGGTGAGAGTGAATCTTTCAAGATCTCGAGATCTTGAAAGATTCACTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-186s21c1
Sequence:CCGGTGAGAGTGAATCTTTCAAGATCTCGAGATCTTGAAAGATTCACTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-210s21c1
Sequence:CCGGCCTCATCTTAGATGTAAACATCTCGAGATGTTTACATCTAAGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-152s21c1
Sequence:CCGGGCAAGAAATTTGACCGAGTATCTCGAGATACTCGGTCAAATTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145632.2-619s21c1
Sequence:CCGGCTGTCGGTGTTAGCCTGTAAACTCGAGTTTACAGGCTAACACCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145632.2-481s21c1
Sequence:CCGGGCCAACAACCTGCATGGATTTCTCGAGAAATCCATGCAGGTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)