EMAIL THIS PAGE TO A FRIEND

POLR2J3

polymerase (RNA) II (DNA directed) polypeptide J3

161 Gene Product Result for
Synonyms: POLR2J2 RPB11b1 RPB11b2
Species: Human POLR2J3(548644)
UniProtKB ID: Q9H1A7, A6NKA1
Gene ID:
Human(548644) Summary: This gene is a member of the RNA polymerase II subunit 11 gene family, which includes three genes in a cluster on chromosome 7q22.1 and a pseudogene on chromosome 7p13. The founding member of this family, DNA directed RNA polymerase II polypeptide J, has been shown to encode a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This locus produces multiple, alternatively spliced transcripts that potentially express isoforms with distinct C-termini compared to DNA directed RNA polymerase II polypeptide J. Most or all variants are spliced to include additional non-coding exons at the 3' end which makes them candidates for nonsense-mediated decay (NMD). Consequently, it is not known if this locus expresses a protein or proteins in vivo. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001015884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001015884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001015884 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015884 Rosetta Predictions human pricing
NM_001097615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192024 predicted 129
2 SASI_Hs01_00192025 predicted 166
3 SASI_Hs01_00192026 predicted 83
4 SASI_Hs01_00192027 predicted 82
5 SASI_Hs01_00192028 predicted 80
6 SASI_Hs01_00192029 predicted 167
7 SASI_Hs01_00192030 predicted 112
8 SASI_Hs01_00192031 predicted 126
9 SASI_Hs01_00192032 predicted 81
10 SASI_Hs01_00192033 predicted 13
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318440 predicted 742
2 SASI_Hs02_00318441 predicted 904
3 SASI_Hs02_00318442 predicted 757
4 SASI_Hs02_00318443 predicted 891
5 SASI_Hs02_00318444 predicted 814
6 SASI_Hs02_00318445 predicted 875
7 SASI_Hs02_00318446 predicted 809
8 SASI_Hs02_00318447 predicted 930
9 SASI_Hs02_00318448 predicted 725
10 SASI_Hs02_00318449 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015884
POLR2J3 MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide J3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-96s1c1
Sequence:CCGGCACCATGAACAAAGAAGACCACTCGAGTGGTCTTCTTTGTTCATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-81s1c1
Sequence:CCGGCAATGCCTGTTTATTCACCATCTCGAGATGGTGAATAAACAGGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-45s1c1
Sequence:CCGGCGAGAAGATCACCATTAACAACTCGAGTTGTTAATGGTGATCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-98s1c1
Sequence:CCGGCCATGAACAAAGAAGACCACACTCGAGTGTGGTCTTCTTTGTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-80s1c1
Sequence:CCGGCCAATGCCTGTTTATTCACCACTCGAGTGGTGAATAAACAGGCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-44s1c1
Sequence:CCGGGCGAGAAGATCACCATTAACACTCGAGTGTTAATGGTGATCTTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-48s1c1
Sequence:CCGGGAAGATCACCATTAACAAGGACTCGAGTCCTTGTTAATGGTGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-86s1c1
Sequence:CCGGCCTGTTTATTCACCATGAACACTCGAGTGTTCATGGTGAATAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-195s1c1
Sequence:CCGGCTTGGAGCACAAGATCATCATCTCGAGATGATGATCTTGTGCTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-102s1c1
Sequence:CCGGGAACAAAGAAGACCACACACTCTCGAGAGTGTGTGGTCTTCTTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015884
POLR2J3 MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide J3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-96s1c1
Sequence:CCGGCACCATGAACAAAGAAGACCACTCGAGTGGTCTTCTTTGTTCATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-81s1c1
Sequence:CCGGCAATGCCTGTTTATTCACCATCTCGAGATGGTGAATAAACAGGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-45s1c1
Sequence:CCGGCGAGAAGATCACCATTAACAACTCGAGTTGTTAATGGTGATCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-98s1c1
Sequence:CCGGCCATGAACAAAGAAGACCACACTCGAGTGTGGTCTTCTTTGTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-80s1c1
Sequence:CCGGCCAATGCCTGTTTATTCACCACTCGAGTGGTGAATAAACAGGCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-44s1c1
Sequence:CCGGGCGAGAAGATCACCATTAACACTCGAGTGTTAATGGTGATCTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-48s1c1
Sequence:CCGGGAAGATCACCATTAACAAGGACTCGAGTCCTTGTTAATGGTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-86s1c1
Sequence:CCGGCCTGTTTATTCACCATGAACACTCGAGTGTTCATGGTGAATAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-195s1c1
Sequence:CCGGCTTGGAGCACAAGATCATCATCTCGAGATGATGATCTTGTGCTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-102s1c1
Sequence:CCGGGAACAAAGAAGACCACACACTCTCGAGAGTGTGTGGTCTTCTTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015884
POLR2J3 MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide J3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-96s1c1
Sequence:CCGGCACCATGAACAAAGAAGACCACTCGAGTGGTCTTCTTTGTTCATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-81s1c1
Sequence:CCGGCAATGCCTGTTTATTCACCATCTCGAGATGGTGAATAAACAGGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-45s1c1
Sequence:CCGGCGAGAAGATCACCATTAACAACTCGAGTTGTTAATGGTGATCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-98s1c1
Sequence:CCGGCCATGAACAAAGAAGACCACACTCGAGTGTGGTCTTCTTTGTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-80s1c1
Sequence:CCGGCCAATGCCTGTTTATTCACCACTCGAGTGGTGAATAAACAGGCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-44s1c1
Sequence:CCGGGCGAGAAGATCACCATTAACACTCGAGTGTTAATGGTGATCTTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-48s1c1
Sequence:CCGGGAAGATCACCATTAACAAGGACTCGAGTCCTTGTTAATGGTGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-86s1c1
Sequence:CCGGCCTGTTTATTCACCATGAACACTCGAGTGTTCATGGTGAATAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-195s1c1
Sequence:CCGGCTTGGAGCACAAGATCATCATCTCGAGATGATGATCTTGTGCTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015884.1-102s1c1
Sequence:CCGGGAACAAAGAAGACCACACACTCTCGAGAGTGTGTGGTCTTCTTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)