EMAIL THIS PAGE TO A FRIEND

POLR2J

polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa

45 Gene Product Result for
Synonyms: POLR2J1 RPB11 RPB11A RPB11m hRPB14
UniProtKB ID: P52435, A5D6V8, O43375
Gene ID:
Human(5439) Summary: This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene exists as a heterodimer with another polymerase subunit; together they form a core subassembly unit of the polymerase. Two similar genes are located nearby on chromosome 7q22.1 and a pseudogene is found on chromosome 7p13. [provided by RefSeq, Jul 2008]
Mouse(20022) polymerase (RNA) II (DNA directed) polypeptide J
Rat(288588) polymerase (RNA) II (DNA directed) polypeptide J
Zebrafish(554099) polymerase (RNA) II (DNA directed) polypeptide J
chicken(101668262) polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
cow(540428) polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Goat(100861038) polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006234 Rosetta Predictions human pricing
NM_001105921 Rosetta Predictions rat pricing
NM_011293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208284 predicted 554
2 SASI_Hs01_00208285 predicted 708
3 SASI_Hs01_00208286 predicted 568
4 SASI_Hs01_00208287 predicted 379
5 SASI_Hs01_00208288 predicted 558
6 SASI_Hs01_00208289 predicted 376
7 SASI_Hs01_00208290 predicted 643
8 SASI_Hs01_00208291 predicted 373
9 SASI_Hs01_00208292 predicted 566
10 SASI_Hs02_00341151 predicted 643
11 SASI_Hs01_00208283 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213852 predicted 425
2 SASI_Rn02_00213853 predicted 412
3 SASI_Rn02_00213854 predicted 420
4 SASI_Rn02_00213855 predicted 355
5 SASI_Rn02_00213856 predicted 299
6 SASI_Rn02_00213857 predicted 391
7 SASI_Rn02_00213858 predicted 213
8 SASI_Rn02_00213859 predicted 368
9 SASI_Rn02_00213860 predicted 410
10 SASI_Rn02_00213861 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320352 predicted 218
2 SASI_Mm01_00162756 predicted 229
3 SASI_Mm02_00320353 predicted 224
4 SASI_Mm02_00320354 predicted 216
5 SASI_Mm02_00320355 predicted 227
6 SASI_Mm01_00162747 predicted 314
7 SASI_Mm02_00320356 predicted 229
8 SASI_Mm01_00162748 predicted 270
9 SASI_Mm01_00162749 predicted 342
10 SASI_Mm01_00162750 predicted 266
11 SASI_Mm01_00162751 predicted 317
12 SASI_Mm01_00162752 predicted 307
13 SASI_Mm01_00162753 predicted 311
14 SASI_Mm01_00162754 predicted 370
15 SASI_Mm01_00162755 predicted 53
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011293
VALIDATED
POLR2J MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-372s1c1
Sequence:CCGGAGCTGAAAGAAGCGTTGCTTACTCGAGTAAGCAACGCTTCTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011293.1-73s1c1
Sequence:CCGGCACCATTAACAAGGACACTAACTCGAGTTAGTGTCCTTGTTAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-82s1c1
Sequence:CCGGCAAGGACACTAAGGTTCCCAACTCGAGTTGGGAACCTTAGTGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-338s1c1
Sequence:CCGGGCCATCAAGGACAAGCAAGAACTCGAGTTCTTGCTTGTCCTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-148s1c1
Sequence:CCGGCATCATTAAATCGCAGCTGTTCTCGAGAACAGCTGCGATTTAATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-128s21c1
Sequence:CCGGCAAGGACACTAAGGTTCCCAACTCGAGTTGGGAACCTTAGTGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-384s21c1
Sequence:CCGGGCCATCAAGGACAAGCAAGAACTCGAGTTCTTGCTTGTCCTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-194s21c1
Sequence:CCGGCATCATTAAATCGCAGCTGTTCTCGAGAACAGCTGCGATTTAATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011293.2-418s21c1
Sequence:CCGGAGCTGAAAGAAGCGTTGCTTACTCGAGTAAGCAACGCTTCTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011293
VALIDATED
POLR2J MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-372s1c1
Sequence:CCGGAGCTGAAAGAAGCGTTGCTTACTCGAGTAAGCAACGCTTCTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011293.1-73s1c1
Sequence:CCGGCACCATTAACAAGGACACTAACTCGAGTTAGTGTCCTTGTTAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-82s1c1
Sequence:CCGGCAAGGACACTAAGGTTCCCAACTCGAGTTGGGAACCTTAGTGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-338s1c1
Sequence:CCGGGCCATCAAGGACAAGCAAGAACTCGAGTTCTTGCTTGTCCTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-148s1c1
Sequence:CCGGCATCATTAAATCGCAGCTGTTCTCGAGAACAGCTGCGATTTAATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-128s21c1
Sequence:CCGGCAAGGACACTAAGGTTCCCAACTCGAGTTGGGAACCTTAGTGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-384s21c1
Sequence:CCGGGCCATCAAGGACAAGCAAGAACTCGAGTTCTTGCTTGTCCTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-194s21c1
Sequence:CCGGCATCATTAAATCGCAGCTGTTCTCGAGAACAGCTGCGATTTAATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011293.2-418s21c1
Sequence:CCGGAGCTGAAAGAAGCGTTGCTTACTCGAGTAAGCAACGCTTCTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011293
VALIDATED
POLR2J MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-372s1c1
Sequence:CCGGAGCTGAAAGAAGCGTTGCTTACTCGAGTAAGCAACGCTTCTTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000111374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011293.1-73s1c1
Sequence:CCGGCACCATTAACAAGGACACTAACTCGAGTTAGTGTCCTTGTTAATGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000111373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-82s1c1
Sequence:CCGGCAAGGACACTAAGGTTCCCAACTCGAGTTGGGAACCTTAGTGTCCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000111371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-338s1c1
Sequence:CCGGGCCATCAAGGACAAGCAAGAACTCGAGTTCTTGCTTGTCCTTGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000111372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011293.1-148s1c1
Sequence:CCGGCATCATTAAATCGCAGCTGTTCTCGAGAACAGCTGCGATTTAATGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-128s21c1
Sequence:CCGGCAAGGACACTAAGGTTCCCAACTCGAGTTGGGAACCTTAGTGTCCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-384s21c1
Sequence:CCGGGCCATCAAGGACAAGCAAGAACTCGAGTTCTTGCTTGTCCTTGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011293.2-194s21c1
Sequence:CCGGCATCATTAAATCGCAGCTGTTCTCGAGAACAGCTGCGATTTAATGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011293.2-418s21c1
Sequence:CCGGAGCTGAAAGAAGCGTTGCTTACTCGAGTAAGCAACGCTTCTTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006234
VALIDATED
POLR2J MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-95s1c1
Sequence:CCGGCGAGAAGAAGATCACCATTAACTCGAGTTAATGGTGATCTTCTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006234.3-380s1c1
Sequence:CCGGAGACAAGCAGGAAGGAATTGACTCGAGTCAATTCCTTCCTGCTTGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006234.3-140s1c1
Sequence:CCGGCTGTTTATTCACCATCAACAACTCGAGTTGTTGATGGTGAATAAACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-357s1c1
Sequence:CCGGGAGCGCTTTCGGGTGGCCATACTCGAGTATGGCCACCCGAAAGCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-212s1c1
Sequence:CCGGGCAAGTGCTATTTGCTGGCTACTCGAGTAGCCAGCAAATAGCACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006234
VALIDATED
POLR2J MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-95s1c1
Sequence:CCGGCGAGAAGAAGATCACCATTAACTCGAGTTAATGGTGATCTTCTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006234.3-380s1c1
Sequence:CCGGAGACAAGCAGGAAGGAATTGACTCGAGTCAATTCCTTCCTGCTTGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006234.3-140s1c1
Sequence:CCGGCTGTTTATTCACCATCAACAACTCGAGTTGTTGATGGTGAATAAACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-357s1c1
Sequence:CCGGGAGCGCTTTCGGGTGGCCATACTCGAGTATGGCCACCCGAAAGCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-212s1c1
Sequence:CCGGGCAAGTGCTATTTGCTGGCTACTCGAGTAGCCAGCAAATAGCACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006234
VALIDATED
POLR2J MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-95s1c1
Sequence:CCGGCGAGAAGAAGATCACCATTAACTCGAGTTAATGGTGATCTTCTTCTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006234.3-380s1c1
Sequence:CCGGAGACAAGCAGGAAGGAATTGACTCGAGTCAATTCCTTCCTGCTTGTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006234.3-140s1c1
Sequence:CCGGCTGTTTATTCACCATCAACAACTCGAGTTGTTGATGGTGAATAAACAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-357s1c1
Sequence:CCGGGAGCGCTTTCGGGTGGCCATACTCGAGTATGGCCACCCGAAAGCGCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006234.3-212s1c1
Sequence:CCGGGCAAGTGCTATTTGCTGGCTACTCGAGTAGCCAGCAAATAGCACTTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???