EMAIL THIS PAGE TO A FRIEND

POLR2K

polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa

55 Gene Product Result for
Synonyms: ABC10-alpha RPABC4 RPB10alpha RPB12 RPB7.0 hRPB7.0 hsRPB10a
UniProtKB ID: P53803, Q6IBD4
Gene ID:
Human(5440) Summary: This gene encodes one of the smallest subunits of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases. [provided by RefSeq, Jul 2008]
Mouse(17749) polymerase (RNA) II (DNA directed) polypeptide K
Rat(100361574) polymerase (RNA) II (DNA directed) polypeptide K
Zebrafish(796803) polymerase (RNA) II (DNA directed) polypeptide K
chicken(768387) polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
domestic cat(101097129) polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
domestic guinea pig(100731078) polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
naked mole-rat(101718217) polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
cow(614776) polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
sheep(101104250) polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005034 Rosetta Predictions human pricing
NM_001039368 Rosetta Predictions mouse pricing
NM_023127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025174 predicted 196
2 SASI_Hs02_00338820 predicted 303
3 SASI_Hs01_00025175 predicted 215
4 SASI_Hs01_00025176 predicted 135
5 SASI_Hs01_00025177 predicted 338
6 SASI_Hs02_00338821 predicted 131
7 SASI_Hs02_00338822 predicted 114
8 SASI_Hs01_00025181 predicted 288
9 SASI_Hs01_00025182 predicted 336
10 SASI_Hs02_00338823 predicted 331
11 SASI_Hs01_00025178 predicted 743
12 SASI_Hs01_00025179 predicted 743
13 SASI_Hs01_00025180 predicted 130
14 SASI_Hs01_00025183 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126425 predicted 386
2 SASI_Mm01_00126426 predicted 371
3 SASI_Mm01_00126427 predicted 397
4 SASI_Mm01_00126429 predicted 381
5 SASI_Mm01_00126430 predicted 211
6 SASI_Mm01_00126431 predicted 280
7 SASI_Mm01_00126432 predicted 211
8 SASI_Mm02_00290021 predicted 380
9 SASI_Mm02_00290022 predicted 239
10 SASI_Mm02_00290023 predicted 395
11 SASI_Mm01_00126423 predicted 321
12 SASI_Mm01_00126424 predicted 323
13 SASI_Mm01_00126428 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111670 predicted 253
2 SASI_Mm01_00111671 predicted 241
3 SASI_Mm01_00111672 predicted 252
4 SASI_Mm01_00111673 predicted 247
5 SASI_Mm01_00111674 predicted 246
6 SASI_Mm01_00111675 predicted 256
7 SASI_Mm01_00111676 predicted 251
8 SASI_Mm01_00111677 predicted 241
9 SASI_Mm01_00111678 predicted 253
10 SASI_Mm01_00111679 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005034
VALIDATED
POLR2K MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-210s21c1
Sequence:CCGGCAGATGCAGAGAATGTGGATACTCGAGTATCCACATTCTCTGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-271s21c1
Sequence:CCGGTTTGATGCTCGATGAATGCTGCTCGAGCAGCATTCATCGAGCATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-115s21c1
Sequence:CCGGACCCAGAAGGACGTTCAACCTCTCGAGAGGTTGAACGTCCTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-168s1c1
Sequence:CCGGCAGATGCAGAGAATGTGGATACTCGAGTATCCACATTCTCTGCATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-141s21c1
Sequence:CCGGGCAGCAACCAATGATATATATCTCGAGATATATATCATTGGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005034.3-613s21c1
Sequence:CCGGTTGTACAGTACTCACCTATTTCTCGAGAAATAGGTGAGTACTGTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-122s1c1
Sequence:CCGGGTGGAGAGTGTCACACAGAAACTCGAGTTTCTGTGTGACACTCTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-98s1c1
Sequence:CCGGAGCAGCAACCAATGATATATACTCGAGTATATATCATTGGTTGCTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-106s1c1
Sequence:CCGGCCAATGATATATATCTGTGGACTCGAGTCCACAGATATATATCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-174s1c1
Sequence:CCGGCAGAGAATGTGGATACAGAATCTCGAGATTCTGTATCCACATTCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005034
VALIDATED
POLR2K MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-210s21c1
Sequence:CCGGCAGATGCAGAGAATGTGGATACTCGAGTATCCACATTCTCTGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-271s21c1
Sequence:CCGGTTTGATGCTCGATGAATGCTGCTCGAGCAGCATTCATCGAGCATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-115s21c1
Sequence:CCGGACCCAGAAGGACGTTCAACCTCTCGAGAGGTTGAACGTCCTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-168s1c1
Sequence:CCGGCAGATGCAGAGAATGTGGATACTCGAGTATCCACATTCTCTGCATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-141s21c1
Sequence:CCGGGCAGCAACCAATGATATATATCTCGAGATATATATCATTGGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005034.3-613s21c1
Sequence:CCGGTTGTACAGTACTCACCTATTTCTCGAGAAATAGGTGAGTACTGTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-122s1c1
Sequence:CCGGGTGGAGAGTGTCACACAGAAACTCGAGTTTCTGTGTGACACTCTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-98s1c1
Sequence:CCGGAGCAGCAACCAATGATATATACTCGAGTATATATCATTGGTTGCTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-106s1c1
Sequence:CCGGCCAATGATATATATCTGTGGACTCGAGTCCACAGATATATATCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-174s1c1
Sequence:CCGGCAGAGAATGTGGATACAGAATCTCGAGATTCTGTATCCACATTCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005034
VALIDATED
POLR2K MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-210s21c1
Sequence:CCGGCAGATGCAGAGAATGTGGATACTCGAGTATCCACATTCTCTGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-271s21c1
Sequence:CCGGTTTGATGCTCGATGAATGCTGCTCGAGCAGCATTCATCGAGCATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-115s21c1
Sequence:CCGGACCCAGAAGGACGTTCAACCTCTCGAGAGGTTGAACGTCCTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-168s1c1
Sequence:CCGGCAGATGCAGAGAATGTGGATACTCGAGTATCCACATTCTCTGCATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005034.3-141s21c1
Sequence:CCGGGCAGCAACCAATGATATATATCTCGAGATATATATCATTGGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005034.3-613s21c1
Sequence:CCGGTTGTACAGTACTCACCTATTTCTCGAGAAATAGGTGAGTACTGTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-122s1c1
Sequence:CCGGGTGGAGAGTGTCACACAGAAACTCGAGTTTCTGTGTGACACTCTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-98s1c1
Sequence:CCGGAGCAGCAACCAATGATATATACTCGAGTATATATCATTGGTTGCTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-106s1c1
Sequence:CCGGCCAATGATATATATCTGTGGACTCGAGTCCACAGATATATATCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005034.2-174s1c1
Sequence:CCGGCAGAGAATGTGGATACAGAATCTCGAGATTCTGTATCCACATTCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023127
VALIDATED
POLR2K MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-107s21c1
Sequence:CCGGGCAGCAGCCAATGATATATATCTCGAGATATATATCATTGGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023127.2-289s21c1
Sequence:CCGGGCCTCATTGATGTTTCTCTTTCTCGAGAAAGAGAAACATCAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-155s21c1
Sequence:CCGGGATAAAGTCCAGGGATCCCATCTCGAGATGGGATCCCTGGACTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-147s1c1
Sequence:CCGGGCAGAGAATGTGGATACAGAACTCGAGTTCTGTATCCACATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-181s21c1
Sequence:CCGGGCAGAGAATGTGGATACAGAACTCGAGTTCTGTATCCACATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-73s1c1
Sequence:CCGGGCAGCAGCCAATGATATATATCTCGAGATATATATCATTGGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-96s1c1
Sequence:CCGGGTGGAGAGTGTCACACCGAAACTCGAGTTTCGGTGTGACACTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-255s1c1
Sequence:CCGGGCCTCATTGATGTTTCTCTTTCTCGAGAAAGAGAAACATCAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-121s1c1
Sequence:CCGGGATAAAGTCCAGGGATCCCATCTCGAGATGGGATCCCTGGACTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-130s21c1
Sequence:CCGGGTGGAGAGTGTCACACCGAAACTCGAGTTTCGGTGTGACACTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023127
VALIDATED
POLR2K MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-107s21c1
Sequence:CCGGGCAGCAGCCAATGATATATATCTCGAGATATATATCATTGGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023127.2-289s21c1
Sequence:CCGGGCCTCATTGATGTTTCTCTTTCTCGAGAAAGAGAAACATCAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-155s21c1
Sequence:CCGGGATAAAGTCCAGGGATCCCATCTCGAGATGGGATCCCTGGACTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-147s1c1
Sequence:CCGGGCAGAGAATGTGGATACAGAACTCGAGTTCTGTATCCACATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-181s21c1
Sequence:CCGGGCAGAGAATGTGGATACAGAACTCGAGTTCTGTATCCACATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-73s1c1
Sequence:CCGGGCAGCAGCCAATGATATATATCTCGAGATATATATCATTGGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-96s1c1
Sequence:CCGGGTGGAGAGTGTCACACCGAAACTCGAGTTTCGGTGTGACACTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-255s1c1
Sequence:CCGGGCCTCATTGATGTTTCTCTTTCTCGAGAAAGAGAAACATCAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-121s1c1
Sequence:CCGGGATAAAGTCCAGGGATCCCATCTCGAGATGGGATCCCTGGACTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-130s21c1
Sequence:CCGGGTGGAGAGTGTCACACCGAAACTCGAGTTTCGGTGTGACACTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023127
VALIDATED
POLR2K MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-107s21c1
Sequence:CCGGGCAGCAGCCAATGATATATATCTCGAGATATATATCATTGGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023127.2-289s21c1
Sequence:CCGGGCCTCATTGATGTTTCTCTTTCTCGAGAAAGAGAAACATCAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-155s21c1
Sequence:CCGGGATAAAGTCCAGGGATCCCATCTCGAGATGGGATCCCTGGACTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-147s1c1
Sequence:CCGGGCAGAGAATGTGGATACAGAACTCGAGTTCTGTATCCACATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-181s21c1
Sequence:CCGGGCAGAGAATGTGGATACAGAACTCGAGTTCTGTATCCACATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-73s1c1
Sequence:CCGGGCAGCAGCCAATGATATATATCTCGAGATATATATCATTGGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-96s1c1
Sequence:CCGGGTGGAGAGTGTCACACCGAAACTCGAGTTTCGGTGTGACACTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-255s1c1
Sequence:CCGGGCCTCATTGATGTTTCTCTTTCTCGAGAAAGAGAAACATCAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023127.1-121s1c1
Sequence:CCGGGATAAAGTCCAGGGATCCCATCTCGAGATGGGATCCCTGGACTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023127.2-130s21c1
Sequence:CCGGGTGGAGAGTGTCACACCGAAACTCGAGTTTCGGTGTGACACTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)