EMAIL THIS PAGE TO A FRIEND

POLR2L

polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa

78 Gene Product Result for
Synonyms: RBP10 RPABC5 RPB10 RPB10beta RPB7.6 hRPB7.6
UniProtKB ID: P62875, P52436, Q6FHX3
Gene ID:
Human(5441) Summary: This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains four conserved cysteines characteristic of an atypical zinc-binding domain. Like its counterpart in yeast, this subunit may be shared by the other two DNA-directed RNA polymerases. [provided by RefSeq, Jul 2008]
Mouse(66491) polymerase (RNA) II (DNA directed) polypeptide L
Rat(502374) polymerase (RNA) II (DNA directed) polypeptide L
Zebrafish(553705) polymerase (RNA) II (DNA directed) polypeptide L
chicken(770704) polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
cow(617375) polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
naked mole-rat(101723718) polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
domestic guinea pig(100716116) polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_888022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_888022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_888022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021128 Rosetta Predictions human pricing
XM_577849 Rosetta Predictions rat pricing
XR_007265 Rosetta Predictions rat pricing
XR_009623 Rosetta Predictions rat pricing
XM_888022 Rosetta Predictions mouse pricing
XM_916953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243512 predicted 234
2 SASI_Hs01_00243513 predicted 364
3 SASI_Hs01_00243514 predicted 429
4 SASI_Hs01_00243516 predicted 292
5 SASI_Hs01_00243517 predicted 312
6 SASI_Hs01_00243518 predicted 350
7 SASI_Hs01_00243519 predicted 319
8 SASI_Hs01_00243520 predicted 358
9 SASI_Hs01_00243521 predicted 356
10 SASI_Hs02_00354644 predicted 392
11 SASI_Hs01_00243515 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181452 predicted 320
2 SASI_Rn01_00181453 predicted 510
3 SASI_Rn01_00181454 predicted 522
4 SASI_Rn01_00181455 predicted 545
5 SASI_Rn01_00181456 predicted 263
6 SASI_Rn01_00181457 predicted 514
7 SASI_Rn01_00181458 predicted 521
8 SASI_Rn01_00181459 predicted 313
9 SASI_Rn01_00181460 predicted 285
10 SASI_Rn01_00181461 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00414151 predicted 228
2 SASI_Rn02_00414152 predicted 497
3 SASI_Rn02_00414153 predicted 409
4 SASI_Rn02_00414154 predicted 415
5 SASI_Rn02_00414155 predicted 411
6 SASI_Rn02_00414156 predicted 492
7 SASI_Rn02_00414157 predicted 223
8 SASI_Rn02_00414158 predicted 540
9 SASI_Rn02_00414159 predicted 833
10 SASI_Rn02_00414160 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420403 predicted 223
2 SASI_Rn02_00420404 predicted 497
3 SASI_Rn02_00420405 predicted 416
4 SASI_Rn02_00420406 predicted 417
5 SASI_Rn02_00420407 predicted 414
6 SASI_Rn02_00420408 predicted 495
7 SASI_Rn02_00420409 predicted 229
8 SASI_Rn02_00420410 predicted 540
9 SASI_Rn02_00420411 predicted 839
10 SASI_Rn02_00420412 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284379 predicted 1496
2 SASI_Mm01_00284380 predicted 1463
3 SASI_Mm01_00284384 predicted 1343
4 SASI_Mm02_00428589 predicted 279
5 SASI_Mm02_00428590 predicted 567
6 SASI_Mm01_00284387 predicted 1629
7 SASI_Mm01_00284388 predicted 1323
8 SASI_Mm02_00428591 predicted 557
9 SASI_Mm02_00428592 predicted 1507
10 SASI_Mm02_00428593 predicted 307
11 SASI_Mm01_00284381 predicted 743
12 SASI_Mm01_00284382 predicted 319
13 SASI_Mm01_00284383 predicted 312
14 SASI_Mm01_00284385 predicted 668
15 SASI_Mm01_00284386 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440721 predicted 1488
2 SASI_Mm02_00440722 predicted 1461
3 SASI_Mm02_00440723 predicted 1340
4 SASI_Mm02_00440724 predicted 282
5 SASI_Mm02_00440725 predicted 568
6 SASI_Mm02_00440726 predicted 1632
7 SASI_Mm02_00440727 predicted 1326
8 SASI_Mm02_00440728 predicted 558
9 SASI_Mm02_00440729 predicted 1507
10 SASI_Mm02_00440730 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021128
VALIDATED
POLR2L MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-174s1c1
Sequence:CCGGCCACGTGGACCTGATCGAGAACTCGAGTTCTCGATCAGGTCCACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021128.3-63s1c1
Sequence:CCGGCGGCAACAAGTGGGAGGCTTACTCGAGTAAGCCTCCCACTTGTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-184s1c1
Sequence:CCGGCTGATCGAGAAGCTGCTCAATCTCGAGATTGAGCAGCTTCTCGATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-190s1c1
Sequence:CCGGGAGAAGCTGCTCAATTATGCACTCGAGTGCATAATTGAGCAGCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-51s1c1
Sequence:CCGGTGGCAAGATCGTCGGCAACAACTCGAGTTGTTGCCGACGATCTTGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-174s21c1
Sequence:CCGGCCACGTGGACCTGATCGAGAACTCGAGTTCTCGATCAGGTCCACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-190s21c1
Sequence:CCGGGAGAAGCTGCTCAATTATGCACTCGAGTGCATAATTGAGCAGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-51s21c1
Sequence:CCGGTGGCAAGATCGTCGGCAACAACTCGAGTTGTTGCCGACGATCTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-359s21c1
Sequence:CCGGGGAAGGAACCATCCAGTAAAGCTCGAGCTTTACTGGATGGTTCCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-217s21c1
Sequence:CCGGGAGAAGTGACCACGCTGGAACCTCGAGGTTCCAGCGTGGTCACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021128
VALIDATED
POLR2L MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-174s1c1
Sequence:CCGGCCACGTGGACCTGATCGAGAACTCGAGTTCTCGATCAGGTCCACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021128.3-63s1c1
Sequence:CCGGCGGCAACAAGTGGGAGGCTTACTCGAGTAAGCCTCCCACTTGTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-184s1c1
Sequence:CCGGCTGATCGAGAAGCTGCTCAATCTCGAGATTGAGCAGCTTCTCGATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-190s1c1
Sequence:CCGGGAGAAGCTGCTCAATTATGCACTCGAGTGCATAATTGAGCAGCTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-51s1c1
Sequence:CCGGTGGCAAGATCGTCGGCAACAACTCGAGTTGTTGCCGACGATCTTGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-174s21c1
Sequence:CCGGCCACGTGGACCTGATCGAGAACTCGAGTTCTCGATCAGGTCCACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-190s21c1
Sequence:CCGGGAGAAGCTGCTCAATTATGCACTCGAGTGCATAATTGAGCAGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-51s21c1
Sequence:CCGGTGGCAAGATCGTCGGCAACAACTCGAGTTGTTGCCGACGATCTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-359s21c1
Sequence:CCGGGGAAGGAACCATCCAGTAAAGCTCGAGCTTTACTGGATGGTTCCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-217s21c1
Sequence:CCGGGAGAAGTGACCACGCTGGAACCTCGAGGTTCCAGCGTGGTCACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021128
VALIDATED
POLR2L MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-174s1c1
Sequence:CCGGCCACGTGGACCTGATCGAGAACTCGAGTTCTCGATCAGGTCCACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021128.3-63s1c1
Sequence:CCGGCGGCAACAAGTGGGAGGCTTACTCGAGTAAGCCTCCCACTTGTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-184s1c1
Sequence:CCGGCTGATCGAGAAGCTGCTCAATCTCGAGATTGAGCAGCTTCTCGATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-190s1c1
Sequence:CCGGGAGAAGCTGCTCAATTATGCACTCGAGTGCATAATTGAGCAGCTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021128.3-51s1c1
Sequence:CCGGTGGCAAGATCGTCGGCAACAACTCGAGTTGTTGCCGACGATCTTGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-174s21c1
Sequence:CCGGCCACGTGGACCTGATCGAGAACTCGAGTTCTCGATCAGGTCCACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-190s21c1
Sequence:CCGGGAGAAGCTGCTCAATTATGCACTCGAGTGCATAATTGAGCAGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-51s21c1
Sequence:CCGGTGGCAAGATCGTCGGCAACAACTCGAGTTGTTGCCGACGATCTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-359s21c1
Sequence:CCGGGGAAGGAACCATCCAGTAAAGCTCGAGCTTTACTGGATGGTTCCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021128.4-217s21c1
Sequence:CCGGGAGAAGTGACCACGCTGGAACCTCGAGGTTCCAGCGTGGTCACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_888022
POLR2L MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-697s21c1
Sequence:CCGGTGCGCCACCACCACTTGTTAACTCGAGTTAACAAGTGGTGGTGGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-43s21c1
Sequence:GTACCGGCGTAATGGAAACTTGAGGTTTCTCGAGAAACCTCAAGTTTCCATTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_888022.3-1688s21c1
Sequence:CCGGTCCTTGTGCTAGGGTTATTATCTCGAGATAATAACCCTAGCACAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-392s21c1
Sequence:CCGGCTCCGCGTCTGAGCCAAATATCTCGAGATATTTGGCTCAGACGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-146s21c1
Sequence:CCGGGCTTCGGAACTGTGGCAAATGCTCGAGCATTTGCCACAGTTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_888022
POLR2L MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-697s21c1
Sequence:CCGGTGCGCCACCACCACTTGTTAACTCGAGTTAACAAGTGGTGGTGGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-43s21c1
Sequence:GTACCGGCGTAATGGAAACTTGAGGTTTCTCGAGAAACCTCAAGTTTCCATTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_888022.3-1688s21c1
Sequence:CCGGTCCTTGTGCTAGGGTTATTATCTCGAGATAATAACCCTAGCACAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-392s21c1
Sequence:CCGGCTCCGCGTCTGAGCCAAATATCTCGAGATATTTGGCTCAGACGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-146s21c1
Sequence:CCGGGCTTCGGAACTGTGGCAAATGCTCGAGCATTTGCCACAGTTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_888022
POLR2L MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-697s21c1
Sequence:CCGGTGCGCCACCACCACTTGTTAACTCGAGTTAACAAGTGGTGGTGGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-43s21c1
Sequence:GTACCGGCGTAATGGAAACTTGAGGTTTCTCGAGAAACCTCAAGTTTCCATTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_888022.3-1688s21c1
Sequence:CCGGTCCTTGTGCTAGGGTTATTATCTCGAGATAATAACCCTAGCACAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-392s21c1
Sequence:CCGGCTCCGCGTCTGAGCCAAATATCTCGAGATATTTGGCTCAGACGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_888022.3-146s21c1
Sequence:CCGGGCTTCGGAACTGTGGCAAATGCTCGAGCATTTGCCACAGTTCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)