EMAIL THIS PAGE TO A FRIEND

POLR2M

polymerase (RNA) II (DNA directed) polypeptide M

73 Gene Product Result for
Synonyms: GCOM1 GRINL1A Gdown Gdown1
Gene ID:
Human(81488) Summary: This gene encodes a subunit of RNA polymerase II, a protein complex that is responsible for synthesizing messenger RNA in eukaryotes. The encoded protein functions as a component of a specific form of RNA polymerase II termed Pol II(G). This protein may act as a negative regulator of activator-dependent transcription. Alternate splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream gene MYZAP (myocardial zonula adherens protein). [provided by RefSeq, Nov 2011]
Mouse(28015) polymerase (RNA) II (DNA directed) polypeptide M
Rat(192147) polymerase (RNA) II (DNA directed) polypeptide M
Zebrafish(555796) polymerase (RNA) II (DNA directed) polypeptide M
dog(100684569) polymerase (RNA) II (DNA directed) polypeptide M
domestic cat(101083180) polymerase (RNA) II (DNA directed) polypeptide M
domestic guinea pig(101787302) polymerase (RNA) II (DNA directed) polypeptide M
cow(100125877) polymerase (RNA) II (DNA directed) polypeptide M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015532 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035741 MISSION® esiRNA esiRNA targeting mouse Grinl1a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018102 Rosetta Predictions human pricing
NM_001018103 Rosetta Predictions human pricing
NM_015532 Rosetta Predictions human pricing
NM_183402 Rosetta Predictions rat pricing
NM_178602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132499 predicted 818
2 SASI_Hs01_00132500 predicted 783
3 SASI_Hs01_00132507 predicted 824
4 SASI_Hs01_00132508 predicted 842
5 SASI_Hs02_00307012 predicted 211
6 SASI_Hs02_00307013 predicted 850
7 SASI_Hs02_00307014 predicted 770
8 SASI_Hs01_00132501 predicted 463
9 SASI_Hs01_00132502 predicted 503
10 SASI_Hs01_00132503 predicted 350
11 SASI_Hs01_00132504 predicted 717
12 SASI_Hs01_00132505 predicted 286
13 SASI_Hs01_00132506 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221872 predicted 538
2 SASI_Hs01_00221874 predicted 635
3 SASI_Hs01_00221875 predicted 686
4 SASI_Hs01_00221876 predicted 665
5 SASI_Hs01_00221877 predicted 634
6 SASI_Hs01_00221878 predicted 552
7 SASI_Hs01_00221879 predicted 659
8 SASI_Hs02_00307015 predicted 660
9 SASI_Hs01_00221880 predicted 357
10 SASI_Hs01_00221881 predicted 359
11 SASI_Hs01_00221873 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064480 predicted 1293
2 SASI_Hs01_00064482 predicted 351
3 SASI_Hs01_00064484 predicted 1249
4 SASI_Hs01_00064485 predicted 927
5 SASI_Hs01_00064486 predicted 480
6 SASI_Hs01_00064487 predicted 972
7 SASI_Hs02_00348046 predicted 1176
8 SASI_Hs02_00348047 predicted 1293
9 SASI_Hs02_00348048 predicted 1318
10 SASI_Hs02_00348049 predicted 582
11 SASI_Hs01_00064481 predicted 379
12 SASI_Hs01_00064483 predicted 368
13 SASI_Hs01_00064488 predicted 831
14 SASI_Hs01_00064489 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269889 predicted 781
2 SASI_Rn02_00269890 predicted 707
3 SASI_Rn02_00269891 predicted 284
4 SASI_Rn02_00269892 predicted 1168
5 SASI_Rn02_00269893 predicted 1162
6 SASI_Rn02_00269894 predicted 758
7 SASI_Rn02_00269895 predicted 197
8 SASI_Rn02_00269896 predicted 373
9 SASI_Rn02_00269897 predicted 429
10 SASI_Rn02_00269898 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112154 predicted 1247
2 SASI_Mm01_00112155 predicted 779
3 SASI_Mm01_00112156 predicted 417
4 SASI_Mm01_00112157 predicted 868
5 SASI_Mm01_00112158 predicted 1266
6 SASI_Mm01_00112159 predicted 791
7 SASI_Mm01_00112160 predicted 845
8 SASI_Mm02_00348943 predicted 236
9 SASI_Mm01_00112161 predicted 455
10 SASI_Mm01_00112162 predicted 377
11 SASI_Mm01_00112163 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178602
VALIDATED
POLR2M MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide M
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178602.1-798s1c1
Sequence:CCGGCCTCATTACATGAAAGTGCTACTCGAGTAGCACTTTCATGTAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-1620s1c1
Sequence:CCGGCGCTCAAGAAATGAAGTGTAACTCGAGTTACACTTCATTTCTTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-1110s1c1
Sequence:CCGGGCCGAGAGACTGAATATTAAACTCGAGTTTAATATTCAGTCTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-334s1c1
Sequence:CCGGGTGAACTGTTTCATCCTGTTACTCGAGTAACAGGATGAAACAGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-681s1c1
Sequence:CCGGGACAGTCTCTTCATCACTAAACTCGAGTTTAGTGATGAAGAGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178602
VALIDATED
POLR2M MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide M
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178602.1-798s1c1
Sequence:CCGGCCTCATTACATGAAAGTGCTACTCGAGTAGCACTTTCATGTAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-1620s1c1
Sequence:CCGGCGCTCAAGAAATGAAGTGTAACTCGAGTTACACTTCATTTCTTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-1110s1c1
Sequence:CCGGGCCGAGAGACTGAATATTAAACTCGAGTTTAATATTCAGTCTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-334s1c1
Sequence:CCGGGTGAACTGTTTCATCCTGTTACTCGAGTAACAGGATGAAACAGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-681s1c1
Sequence:CCGGGACAGTCTCTTCATCACTAAACTCGAGTTTAGTGATGAAGAGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178602
VALIDATED
POLR2M MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide M
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178602.1-798s1c1
Sequence:CCGGCCTCATTACATGAAAGTGCTACTCGAGTAGCACTTTCATGTAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-1620s1c1
Sequence:CCGGCGCTCAAGAAATGAAGTGTAACTCGAGTTACACTTCATTTCTTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-1110s1c1
Sequence:CCGGGCCGAGAGACTGAATATTAAACTCGAGTTTAATATTCAGTCTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-334s1c1
Sequence:CCGGGTGAACTGTTTCATCCTGTTACTCGAGTAACAGGATGAAACAGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178602.1-681s1c1
Sequence:CCGGGACAGTCTCTTCATCACTAAACTCGAGTTTAGTGATGAAGAGACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015532
VALIDATED
POLR2M MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) II (DNA directed) polypeptide M
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015532.2-811s1c1
Sequence:CCGGCCTCATTACATGGAAGTGCTACTCGAGTAGCACTTCCATGTAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015532.2-529s1c1
Sequence:CCGGCCTACTCTTGAAGGTGATGAACTCGAGTTCATCACCTTCAAGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-354s1c1
Sequence:CCGGCCCTGTTAGTTTAGACTGTAACTCGAGTTACAGTCTAAACTAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-292s1c1
Sequence:CCGGGCCAAACTGAAAGCTGCTATTCTCGAGAATAGCAGCTTTCAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-1057s1c1
Sequence:CCGGGCACTTCAGAAACAGCAGAAACTCGAGTTTCTGCTGTTTCTGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015532.3-699s21c1
Sequence:CCGGAGCTTTGACAACCTGTTTATTCTCGAGAATAAACAGGTTGTCAAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015532.3-413s21c1
Sequence:CCGGAGTTGATGTGGGTACAGATAACTCGAGTTATCTGTACCCACATCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015532
VALIDATED
POLR2M MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) II (DNA directed) polypeptide M
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015532.2-811s1c1
Sequence:CCGGCCTCATTACATGGAAGTGCTACTCGAGTAGCACTTCCATGTAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015532.2-529s1c1
Sequence:CCGGCCTACTCTTGAAGGTGATGAACTCGAGTTCATCACCTTCAAGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-354s1c1
Sequence:CCGGCCCTGTTAGTTTAGACTGTAACTCGAGTTACAGTCTAAACTAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-292s1c1
Sequence:CCGGGCCAAACTGAAAGCTGCTATTCTCGAGAATAGCAGCTTTCAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-1057s1c1
Sequence:CCGGGCACTTCAGAAACAGCAGAAACTCGAGTTTCTGCTGTTTCTGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015532.3-699s21c1
Sequence:CCGGAGCTTTGACAACCTGTTTATTCTCGAGAATAAACAGGTTGTCAAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015532.3-413s21c1
Sequence:CCGGAGTTGATGTGGGTACAGATAACTCGAGTTATCTGTACCCACATCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015532
VALIDATED
POLR2M MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) II (DNA directed) polypeptide M
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015532.2-811s1c1
Sequence:CCGGCCTCATTACATGGAAGTGCTACTCGAGTAGCACTTCCATGTAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015532.2-529s1c1
Sequence:CCGGCCTACTCTTGAAGGTGATGAACTCGAGTTCATCACCTTCAAGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-354s1c1
Sequence:CCGGCCCTGTTAGTTTAGACTGTAACTCGAGTTACAGTCTAAACTAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-292s1c1
Sequence:CCGGGCCAAACTGAAAGCTGCTATTCTCGAGAATAGCAGCTTTCAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015532.2-1057s1c1
Sequence:CCGGGCACTTCAGAAACAGCAGAAACTCGAGTTTCTGCTGTTTCTGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015532.3-699s21c1
Sequence:CCGGAGCTTTGACAACCTGTTTATTCTCGAGAATAAACAGGTTGTCAAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015532.3-413s21c1
Sequence:CCGGAGTTGATGTGGGTACAGATAACTCGAGTTATCTGTACCCACATCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)