EMAIL THIS PAGE TO A FRIEND

POLR3C

polymerase (RNA) III (DNA directed) polypeptide C (62kD)

113 Gene Product Result for
Synonyms: RPC3 RPC62
UniProtKB ID: Q9BUI4, O15317, Q9Y3R6
Gene ID:
Mouse(74414) polymerase (RNA) III (DNA directed) polypeptide C
Rat(310685) polymerase (RNA) III (DNA directed) polypeptide C
cow(507314) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
sheep(101116616) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
domestic guinea pig(100730039) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
naked mole-rat(101698758) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Domestic Rabbit(100341275) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Zebrafish(393201) polymerase (RNA) III (DNA directed) polypeptide C
dog(483159) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
domestic cat(101097504) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
chicken(776505) polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_131049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065771 MISSION® esiRNA esiRNA human POLR3C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006468 Rosetta Predictions human pricing
NM_001012081 Rosetta Predictions rat pricing
XM_575000 Rosetta Predictions rat pricing
XM_131049 Rosetta Predictions mouse pricing
XM_898170 Rosetta Predictions mouse pricing
XM_898189 Rosetta Predictions mouse pricing
XM_898197 Rosetta Predictions mouse pricing
XM_898218 Rosetta Predictions mouse pricing
XM_908475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066727 predicted 1069
2 SASI_Hs01_00066728 predicted 1411
3 SASI_Hs01_00066729 predicted 1179
4 SASI_Hs02_00341636 predicted 846
5 SASI_Hs01_00066731 predicted 1101
6 SASI_Hs01_00066732 predicted 1013
7 SASI_Hs01_00066733 predicted 1476
8 SASI_Hs01_00066734 predicted 1513
9 SASI_Hs02_00341637 predicted 340
10 SASI_Hs01_00066735 predicted 575
11 SASI_Hs01_00066730 predicted 742
12 SASI_Hs01_00066736 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200212 predicted 1052
2 SASI_Rn01_00113362 predicted 1722
3 SASI_Rn01_00113363 predicted 474
4 SASI_Rn01_00113364 predicted 1890
5 SASI_Rn01_00113365 predicted 1617
6 SASI_Rn01_00113367 predicted 707
7 SASI_Rn01_00113368 predicted 1249
8 SASI_Rn01_00113369 predicted 1006
9 SASI_Rn01_00113370 predicted 462
10 SASI_Rn01_00113371 predicted 1688
11 SASI_Rn01_00113366 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180524 predicted 389
2 SASI_Rn01_00180525 predicted 474
3 SASI_Rn01_00180526 predicted 1896
4 SASI_Rn01_00180527 predicted 1902
5 SASI_Rn01_00180528 predicted 493
6 SASI_Rn01_00180529 predicted 472
7 SASI_Rn01_00180530 predicted 1865
8 SASI_Rn01_00180531 predicted 1886
9 SASI_Rn01_00180532 predicted 1867
10 SASI_Rn01_00180533 predicted 1898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424407 predicted 431
2 SASI_Mm01_00280456 predicted 503
3 SASI_Mm01_00280457 predicted 582
4 SASI_Mm01_00280458 predicted 395
5 SASI_Mm01_00280459 predicted 404
6 SASI_Mm01_00280460 predicted 506
7 SASI_Mm01_00280461 predicted 469
8 SASI_Mm01_00280462 predicted 503
9 SASI_Mm02_00424408 predicted 426
10 SASI_Mm01_00280463 predicted 527
11 SASI_Mm01_00280464 predicted 543
12 SASI_Mm01_00280465 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231836 predicted 433
2 SASI_Mm01_00231837 predicted 456
3 SASI_Mm01_00231838 predicted 407
4 SASI_Mm01_00231839 predicted 407
5 SASI_Mm01_00231840 predicted 473
6 SASI_Mm01_00231841 predicted 483
7 SASI_Mm01_00231842 predicted 411
8 SASI_Mm01_00231843 predicted 398
9 SASI_Mm01_00231844 predicted 479
10 SASI_Mm01_00231845 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232788 predicted 505
2 SASI_Mm01_00232789 predicted 594
3 SASI_Mm01_00232790 predicted 400
4 SASI_Mm01_00232791 predicted 409
5 SASI_Mm01_00232792 predicted 512
6 SASI_Mm01_00232793 predicted 481
7 SASI_Mm01_00232794 predicted 507
8 SASI_Mm01_00232795 predicted 527
9 SASI_Mm01_00232796 predicted 538
10 SASI_Mm01_00232797 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236026 predicted 469
2 SASI_Mm01_00236027 predicted 457
3 SASI_Mm01_00236028 predicted 465
4 SASI_Mm01_00236029 predicted 419
5 SASI_Mm01_00236030 predicted 467
6 SASI_Mm01_00236031 predicted 419
7 SASI_Mm01_00236032 predicted 414
8 SASI_Mm01_00236033 predicted 420
9 SASI_Mm01_00236034 predicted 411
10 SASI_Mm01_00236035 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225895 predicted 759
2 SASI_Mm01_00225896 predicted 1090
3 SASI_Mm01_00225897 predicted 1326
4 SASI_Mm01_00225898 predicted 1431
5 SASI_Mm01_00225899 predicted 962
6 SASI_Mm01_00225900 predicted 1386
7 SASI_Mm01_00225901 predicted 1409
8 SASI_Mm01_00225902 predicted 1078
9 SASI_Mm01_00225903 predicted 1135
10 SASI_Mm01_00225904 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434142 predicted 987
2 SASI_Mm02_00434143 predicted 1657
3 SASI_Mm02_00434144 predicted 395
4 SASI_Mm02_00434145 predicted 410
5 SASI_Mm02_00434146 predicted 1186
6 SASI_Mm02_00434147 predicted 1632
7 SASI_Mm02_00434148 predicted 848
8 SASI_Mm02_00434149 predicted 1300
9 SASI_Mm02_00434150 predicted 1360
10 SASI_Mm02_00434151 predicted 1288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006468
VALIDATED
POLR3C MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-438s1c1
Sequence:CCGGCGGTACATCTATACTACCAAACTCGAGTTTGGTAGTATAGATGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-849s1c1
Sequence:CCGGCCCATTCCAGATGATGGGATTCTCGAGAATCCCATCATCTGGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006468.4-583s1c1
Sequence:CCGGCCATGGACTATGCTGAAGTATCTCGAGATACTTCAGCATAGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-273s1c1
Sequence:CCGGCCACTAAGAGTAATTGCCCATCTCGAGATGGGCAATTACTCTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006468.4-1673s1c1
Sequence:CCGGCCTGAAACGTAATGTCAACAACTCGAGTTGTTGACATTACGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-574s21c1
Sequence:CCGGCCATGGACTATGCTGAAGTATCTCGAGATACTTCAGCATAGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1330s21c1
Sequence:CCGGAGGCAAAGGATATGCTATATACTCGAGTATATAGCATATCCTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1046s21c1
Sequence:CCGGATCCCTACCTGTTGGCTATAACTCGAGTTATAGCCAACAGGTAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006468.6-1410s21c1
Sequence:CCGGCCATCCAGGACCTTCTATTTACTCGAGTAAATAGAAGGTCCTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1664s21c1
Sequence:CCGGCCTGAAACGTAATGTCAACAACTCGAGTTGTTGACATTACGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006468
VALIDATED
POLR3C MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-438s1c1
Sequence:CCGGCGGTACATCTATACTACCAAACTCGAGTTTGGTAGTATAGATGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-849s1c1
Sequence:CCGGCCCATTCCAGATGATGGGATTCTCGAGAATCCCATCATCTGGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006468.4-583s1c1
Sequence:CCGGCCATGGACTATGCTGAAGTATCTCGAGATACTTCAGCATAGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-273s1c1
Sequence:CCGGCCACTAAGAGTAATTGCCCATCTCGAGATGGGCAATTACTCTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006468.4-1673s1c1
Sequence:CCGGCCTGAAACGTAATGTCAACAACTCGAGTTGTTGACATTACGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-574s21c1
Sequence:CCGGCCATGGACTATGCTGAAGTATCTCGAGATACTTCAGCATAGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1330s21c1
Sequence:CCGGAGGCAAAGGATATGCTATATACTCGAGTATATAGCATATCCTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1046s21c1
Sequence:CCGGATCCCTACCTGTTGGCTATAACTCGAGTTATAGCCAACAGGTAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006468.6-1410s21c1
Sequence:CCGGCCATCCAGGACCTTCTATTTACTCGAGTAAATAGAAGGTCCTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1664s21c1
Sequence:CCGGCCTGAAACGTAATGTCAACAACTCGAGTTGTTGACATTACGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006468
VALIDATED
POLR3C MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-438s1c1
Sequence:CCGGCGGTACATCTATACTACCAAACTCGAGTTTGGTAGTATAGATGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-849s1c1
Sequence:CCGGCCCATTCCAGATGATGGGATTCTCGAGAATCCCATCATCTGGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006468.4-583s1c1
Sequence:CCGGCCATGGACTATGCTGAAGTATCTCGAGATACTTCAGCATAGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006468.4-273s1c1
Sequence:CCGGCCACTAAGAGTAATTGCCCATCTCGAGATGGGCAATTACTCTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006468.4-1673s1c1
Sequence:CCGGCCTGAAACGTAATGTCAACAACTCGAGTTGTTGACATTACGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-574s21c1
Sequence:CCGGCCATGGACTATGCTGAAGTATCTCGAGATACTTCAGCATAGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1330s21c1
Sequence:CCGGAGGCAAAGGATATGCTATATACTCGAGTATATAGCATATCCTTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1046s21c1
Sequence:CCGGATCCCTACCTGTTGGCTATAACTCGAGTTATAGCCAACAGGTAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006468.6-1410s21c1
Sequence:CCGGCCATCCAGGACCTTCTATTTACTCGAGTAAATAGAAGGTCCTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006468.6-1664s21c1
Sequence:CCGGCCTGAAACGTAATGTCAACAACTCGAGTTGTTGACATTACGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028925
VALIDATED
POLR3C MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000376372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1607s21c1
Sequence:CCGGGACACTGAAACGCAACGTTAACTCGAGTTAACGTTGCGTTTCAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1002s21c1
Sequence:CCGGGTCGGATATAACATCTCTAAACTCGAGTTTAGAGATGTTATATCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1444s21c1
Sequence:CCGGTGATAGAACGGCGACAGTTTGCTCGAGCAAACTGTCGCCGTTCTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028925
VALIDATED
POLR3C MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000376372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1607s21c1
Sequence:CCGGGACACTGAAACGCAACGTTAACTCGAGTTAACGTTGCGTTTCAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1002s21c1
Sequence:CCGGGTCGGATATAACATCTCTAAACTCGAGTTTAGAGATGTTATATCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1444s21c1
Sequence:CCGGTGATAGAACGGCGACAGTTTGCTCGAGCAAACTGTCGCCGTTCTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028925
VALIDATED
POLR3C MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000376372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1607s21c1
Sequence:CCGGGACACTGAAACGCAACGTTAACTCGAGTTAACGTTGCGTTTCAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1002s21c1
Sequence:CCGGGTCGGATATAACATCTCTAAACTCGAGTTTAGAGATGTTATATCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028925.1-1444s21c1
Sequence:CCGGTGATAGAACGGCGACAGTTTGCTCGAGCAAACTGTCGCCGTTCTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131049
VALIDATED
POLR3C MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1245s21c1
Sequence:GTACCGGGATGACCCACTAGAGTTTATTCTCGAGAATAAACTCTAGTGGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1909s21c1
Sequence:CCGGGAAGCAATGCTGGGATCAAACCTCGAGGTTTGATCCCAGCATTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1598s21c1
Sequence:CCGGGCTGTTGCACAGGTGCTATAACTCGAGTTATAGCACCTGTGCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1386s21c1
Sequence:CCGGAGGATATTCCGTCTGGTATTGCTCGAGCAATACCAGACGGAATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-717s21c1
Sequence:CCGGGACTACGCTGAGGTATCAAATCTCGAGATTTGATACCTCAGCGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131049
VALIDATED
POLR3C MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1245s21c1
Sequence:GTACCGGGATGACCCACTAGAGTTTATTCTCGAGAATAAACTCTAGTGGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1909s21c1
Sequence:CCGGGAAGCAATGCTGGGATCAAACCTCGAGGTTTGATCCCAGCATTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1598s21c1
Sequence:CCGGGCTGTTGCACAGGTGCTATAACTCGAGTTATAGCACCTGTGCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1386s21c1
Sequence:CCGGAGGATATTCCGTCTGGTATTGCTCGAGCAATACCAGACGGAATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-717s21c1
Sequence:CCGGGACTACGCTGAGGTATCAAATCTCGAGATTTGATACCTCAGCGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131049
VALIDATED
POLR3C MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1245s21c1
Sequence:GTACCGGGATGACCCACTAGAGTTTATTCTCGAGAATAAACTCTAGTGGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1909s21c1
Sequence:CCGGGAAGCAATGCTGGGATCAAACCTCGAGGTTTGATCCCAGCATTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1598s21c1
Sequence:CCGGGCTGTTGCACAGGTGCTATAACTCGAGTTATAGCACCTGTGCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-1386s21c1
Sequence:CCGGAGGATATTCCGTCTGGTATTGCTCGAGCAATACCAGACGGAATATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_131049.6-717s21c1
Sequence:CCGGGACTACGCTGAGGTATCAAATCTCGAGATTTGATACCTCAGCGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)