EMAIL THIS PAGE TO A FRIEND

POLR3D

polymerase (RNA) III (DNA directed) polypeptide D, 44kDa

148 Gene Product Result for
Synonyms: BN51T RPC4 RPC53 TSBN51
UniProtKB ID: P05423, Q6FI28, Q9BPV7, Q9BPZ1, Q9BXB3
Gene ID:
Human(661) Summary: This gene complements a temperature-sensitive mutant isolated from the BHK-21 Syrian hamster cell line. It leads to a block in progression through the G1 phase of the cell cycle at nonpermissive temperatures. [provided by RefSeq, Jul 2008]
Mouse(67065) polymerase (RNA) III (DNA directed) polypeptide D
Rat(306012) polymerase (RNA) III (DNA directed) polypeptide D
domestic cat(101088833) polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
dog(609056) polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
naked mole-rat(101716370) polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
domestic guinea pig(100729596) polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
cow(508049) polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
sheep(101116536) polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
O8265 Anti-POLR3D (166-180) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
O8390 Anti-POLR3D (276-289) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405521 Anti-POLR3D antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA067875 Anti-POLR3D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA068461 Anti-POLR3D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA061331 Anti-POLR3D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
HPA069089 Anti-POLR3D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4502823 Anti-RPC4, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
WH0000661M1 Monoclonal Anti-POLR3D antibody produced in mouse clone 4E6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001722 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080741 MISSION® esiRNA esiRNA human POLR3D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001722 Rosetta Predictions human pricing
NM_001031653 Rosetta Predictions rat pricing
NM_025945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186708 predicted 710
2 SASI_Hs01_00186709 predicted 392
3 SASI_Hs01_00186710 predicted 459
4 SASI_Hs01_00186711 predicted 983
5 SASI_Hs01_00186712 predicted 771
6 SASI_Hs01_00186713 predicted 1458
7 SASI_Hs01_00186714 predicted 1024
8 SASI_Hs01_00186715 predicted 1261
9 SASI_Hs01_00186716 predicted 991
10 SASI_Hs02_00332422 predicted 442
11 SASI_Hs01_00186707 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102125 predicted 1010
2 SASI_Rn01_00102126 predicted 932
3 SASI_Rn01_00102127 predicted 1648
4 SASI_Rn01_00102128 predicted 613
5 SASI_Rn01_00102129 predicted 895
6 SASI_Rn02_00203598 predicted 964
7 SASI_Rn01_00102130 predicted 919
8 SASI_Rn01_00102131 predicted 1025
9 SASI_Rn01_00102132 predicted 1652
10 SASI_Rn01_00102133 predicted 793
11 SASI_Rn01_00102134 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182530 predicted 956
2 SASI_Mm01_00182531 predicted 1517
3 SASI_Mm01_00182532 predicted 965
4 SASI_Mm01_00182533 predicted 999
5 SASI_Mm01_00182534 predicted 991
6 SASI_Mm01_00182535 predicted 819
7 SASI_Mm01_00182536 predicted 1038
8 SASI_Mm01_00182537 predicted 706
9 SASI_Mm01_00182538 predicted 961
10 SASI_Mm01_00182539 predicted 1388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001722
VALIDATED
POLR3D MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001722.2-1501s21c1
Sequence:CCGGGACTTGGCCCTGCTATTTATTCTCGAGAATAAATAGCAGGGCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-389s21c1
Sequence:CCGGGATCCAGTCTCACTCCATCTTCTCGAGAAGATGGAGTGAGACTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001722.2-1702s21c1
Sequence:CCGGAGGATTGAGTCTGAGACTTAACTCGAGTTAAGTCTCAGACTCAATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-547s1c1
Sequence:CCGGCTGAGGAACGACACTCGAAATCTCGAGATTTCGAGTGTCGTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-483s1c1
Sequence:CCGGAGACGAAGAAACTAAACAGATCTCGAGATCTGTTTAGTTTCTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-964s1c1
Sequence:CCGGGAAGCCAAATTGGCAGAGAATCTCGAGATTCTCTGCCAATTTGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001722.1-219s1c1
Sequence:CCGGCCCAAATATCATCAGTCGGAACTCGAGTTCCGACTGATGATATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001722.1-885s1c1
Sequence:CCGGCCAGGACATCAAGCCTATCAACTCGAGTTGATAGGCTTGATGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-291s21c1
Sequence:CCGGGAGCCCAAGGAAGAAGTAACTCTCGAGAGTTACTTCTTCCTTGGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-740s21c1
Sequence:CCGGGAAAGAGGAGCCACGAGATGACTCGAGTCATCTCGTGGCTCCTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001722
VALIDATED
POLR3D MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001722.2-1501s21c1
Sequence:CCGGGACTTGGCCCTGCTATTTATTCTCGAGAATAAATAGCAGGGCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-389s21c1
Sequence:CCGGGATCCAGTCTCACTCCATCTTCTCGAGAAGATGGAGTGAGACTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001722.2-1702s21c1
Sequence:CCGGAGGATTGAGTCTGAGACTTAACTCGAGTTAAGTCTCAGACTCAATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-547s1c1
Sequence:CCGGCTGAGGAACGACACTCGAAATCTCGAGATTTCGAGTGTCGTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-483s1c1
Sequence:CCGGAGACGAAGAAACTAAACAGATCTCGAGATCTGTTTAGTTTCTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-964s1c1
Sequence:CCGGGAAGCCAAATTGGCAGAGAATCTCGAGATTCTCTGCCAATTTGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001722.1-219s1c1
Sequence:CCGGCCCAAATATCATCAGTCGGAACTCGAGTTCCGACTGATGATATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001722.1-885s1c1
Sequence:CCGGCCAGGACATCAAGCCTATCAACTCGAGTTGATAGGCTTGATGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-291s21c1
Sequence:CCGGGAGCCCAAGGAAGAAGTAACTCTCGAGAGTTACTTCTTCCTTGGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-740s21c1
Sequence:CCGGGAAAGAGGAGCCACGAGATGACTCGAGTCATCTCGTGGCTCCTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001722
VALIDATED
POLR3D MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001722.2-1501s21c1
Sequence:CCGGGACTTGGCCCTGCTATTTATTCTCGAGAATAAATAGCAGGGCCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-389s21c1
Sequence:CCGGGATCCAGTCTCACTCCATCTTCTCGAGAAGATGGAGTGAGACTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001722.2-1702s21c1
Sequence:CCGGAGGATTGAGTCTGAGACTTAACTCGAGTTAAGTCTCAGACTCAATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-547s1c1
Sequence:CCGGCTGAGGAACGACACTCGAAATCTCGAGATTTCGAGTGTCGTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-483s1c1
Sequence:CCGGAGACGAAGAAACTAAACAGATCTCGAGATCTGTTTAGTTTCTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001722.1-964s1c1
Sequence:CCGGGAAGCCAAATTGGCAGAGAATCTCGAGATTCTCTGCCAATTTGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001722.1-219s1c1
Sequence:CCGGCCCAAATATCATCAGTCGGAACTCGAGTTCCGACTGATGATATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001722.1-885s1c1
Sequence:CCGGCCAGGACATCAAGCCTATCAACTCGAGTTGATAGGCTTGATGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-291s21c1
Sequence:CCGGGAGCCCAAGGAAGAAGTAACTCTCGAGAGTTACTTCTTCCTTGGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001722.2-740s21c1
Sequence:CCGGGAAAGAGGAGCCACGAGATGACTCGAGTCATCTCGTGGCTCCTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025945
VALIDATED
POLR3D MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025945.3-1799s21c1
Sequence:CCGGCCGACAGACATGAGGACAATACTCGAGTATTGTCCTCATGTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-1549s21c1
Sequence:CCGGGAACGTGACCCTGCTATTTATCTCGAGATAAATAGCAGGGTCACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-1290s21c1
Sequence:CCGGACTTGTATGTTCTCCTGATTTCTCGAGAAATCAGGAGAACATACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-329s21c1
Sequence:CCGGTCATCAGTCGGAAGATCAAAGCTCGAGCTTTGATCTTCCGACTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025945.3-1028s21c1
Sequence:CCGGATGGACAGATGGTAGTCATAACTCGAGTTATGACTACCATCTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025945.3-1123s21c1
Sequence:CCGGGGCAAACTGCTCATCCGTAAGCTCGAGCTTACGGATGAGCAGTTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-448s21c1
Sequence:CCGGGTGATCCAGTCCCATTCTATCCTCGAGGATAGAATGGGACTGGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-624s1c1
Sequence:CCGGGCTAAAGAATGACACACGGAACTCGAGTTCCGTGTGTCATTCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-519s1c1
Sequence:CCGGACCTTCTCATATCATCAACATCTCGAGATGTTGATGATATGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-1246s1c1
Sequence:CCGGCTGGGACATGTGAAGCACAAACTCGAGTTTGTGCTTCACATGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025945.2-1167s1c1
Sequence:CCGGCATGGGAACGACCTGTTCTTTCTCGAGAAAGAACAGGTCGTTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-785s21c1
Sequence:CCGGTGCCTGCCGTCAAAGTGAAAGCTCGAGCTTTCACTTTGACGGCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025945
VALIDATED
POLR3D MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025945.3-1799s21c1
Sequence:CCGGCCGACAGACATGAGGACAATACTCGAGTATTGTCCTCATGTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-1549s21c1
Sequence:CCGGGAACGTGACCCTGCTATTTATCTCGAGATAAATAGCAGGGTCACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-1290s21c1
Sequence:CCGGACTTGTATGTTCTCCTGATTTCTCGAGAAATCAGGAGAACATACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-329s21c1
Sequence:CCGGTCATCAGTCGGAAGATCAAAGCTCGAGCTTTGATCTTCCGACTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025945.3-1028s21c1
Sequence:CCGGATGGACAGATGGTAGTCATAACTCGAGTTATGACTACCATCTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025945.3-1123s21c1
Sequence:CCGGGGCAAACTGCTCATCCGTAAGCTCGAGCTTACGGATGAGCAGTTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-448s21c1
Sequence:CCGGGTGATCCAGTCCCATTCTATCCTCGAGGATAGAATGGGACTGGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-624s1c1
Sequence:CCGGGCTAAAGAATGACACACGGAACTCGAGTTCCGTGTGTCATTCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-519s1c1
Sequence:CCGGACCTTCTCATATCATCAACATCTCGAGATGTTGATGATATGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-1246s1c1
Sequence:CCGGCTGGGACATGTGAAGCACAAACTCGAGTTTGTGCTTCACATGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025945.2-1167s1c1
Sequence:CCGGCATGGGAACGACCTGTTCTTTCTCGAGAAAGAACAGGTCGTTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-785s21c1
Sequence:CCGGTGCCTGCCGTCAAAGTGAAAGCTCGAGCTTTCACTTTGACGGCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025945
VALIDATED
POLR3D MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025945.3-1799s21c1
Sequence:CCGGCCGACAGACATGAGGACAATACTCGAGTATTGTCCTCATGTCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-1549s21c1
Sequence:CCGGGAACGTGACCCTGCTATTTATCTCGAGATAAATAGCAGGGTCACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-1290s21c1
Sequence:CCGGACTTGTATGTTCTCCTGATTTCTCGAGAAATCAGGAGAACATACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-329s21c1
Sequence:CCGGTCATCAGTCGGAAGATCAAAGCTCGAGCTTTGATCTTCCGACTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025945.3-1028s21c1
Sequence:CCGGATGGACAGATGGTAGTCATAACTCGAGTTATGACTACCATCTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025945.3-1123s21c1
Sequence:CCGGGGCAAACTGCTCATCCGTAAGCTCGAGCTTACGGATGAGCAGTTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-448s21c1
Sequence:CCGGGTGATCCAGTCCCATTCTATCCTCGAGGATAGAATGGGACTGGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-624s1c1
Sequence:CCGGGCTAAAGAATGACACACGGAACTCGAGTTCCGTGTGTCATTCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-519s1c1
Sequence:CCGGACCTTCTCATATCATCAACATCTCGAGATGTTGATGATATGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025945.2-1246s1c1
Sequence:CCGGCTGGGACATGTGAAGCACAAACTCGAGTTTGTGCTTCACATGTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025945.2-1167s1c1
Sequence:CCGGCATGGGAACGACCTGTTCTTTCTCGAGAAAGAACAGGTCGTTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025945.3-785s21c1
Sequence:CCGGTGCCTGCCGTCAAAGTGAAAGCTCGAGCTTTCACTTTGACGGCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)