EMAIL THIS PAGE TO A FRIEND

POLR3E

polymerase (RNA) III (DNA directed) polypeptide E (80kD)

96 Gene Product Result for
Synonyms: RPC5 SIN
Gene ID:
Mouse(26939) polymerase (RNA) III (DNA directed) polypeptide E
Rat(361640) polymerase (RNA) III (DNA directed) polypeptide E
Zebrafish(336518) polymerase (RNA) III (DNA directed) polypeptide E
Horse(100057807) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
domestic cat(101100530) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
dog(608689) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
chicken(416620) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
domestic guinea pig(100719082) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
naked mole-rat(101710118) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Domestic Rabbit(100348140) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
cow(100140537) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
sheep(101103692) polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018119 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018119 Rosetta Predictions human pricing
NM_001108503 Rosetta Predictions rat pricing
NM_025298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205148 predicted 1272
2 SASI_Hs01_00205149 predicted 2179
3 SASI_Hs01_00205150 predicted 1104
4 SASI_Hs01_00205151 predicted 2188
5 SASI_Hs01_00205152 predicted 2269
6 SASI_Hs01_00205153 predicted 1428
7 SASI_Hs01_00205154 predicted 1010
8 SASI_Hs01_00205155 predicted 2214
9 SASI_Hs01_00205156 predicted 225
10 SASI_Hs01_00205157 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239289 predicted 423
2 SASI_Rn02_00239290 predicted 1126
3 SASI_Rn02_00239291 predicted 274
4 SASI_Rn02_00239292 predicted 998
5 SASI_Rn02_00239293 predicted 1858
6 SASI_Rn02_00239294 predicted 1793
7 SASI_Rn02_00239295 predicted 1802
8 SASI_Rn02_00239296 predicted 2046
9 SASI_Rn02_00239297 predicted 2225
10 SASI_Rn02_00239298 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167810 predicted 877
2 SASI_Mm01_00167811 predicted 260
3 SASI_Mm01_00167812 predicted 409
4 SASI_Mm01_00167813 predicted 2270
5 SASI_Mm01_00167814 predicted 1107
6 SASI_Mm01_00167815 predicted 1870
7 SASI_Mm01_00167816 predicted 485
8 SASI_Mm01_00167817 predicted 1893
9 SASI_Mm01_00167818 predicted 2219
10 SASI_Mm01_00167819 predicted 1854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018119
VALIDATED
POLR3E MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-263s21c1
Sequence:CCGGCGATGACCTACGATGACATTCCTCGAGGAATGTCATCGTAGGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-1212s1c1
Sequence:CCGGCCGAGACTTCGTTATGTGGAACTCGAGTTCCACATAACGAAGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-355s1c1
Sequence:CCGGCCCAACTATTGCCGCAGCAAACTCGAGTTTGCTGCGGCAATAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-1858s1c1
Sequence:CCGGGCCACCTTTCAGAGACAGTTTCTCGAGAAACTGTCTCTGAAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-2194s1c1
Sequence:CCGGCTCAGTAAACAGGAGGTGGATCTCGAGATCCACCTCCTGTTTACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-993s1c1
Sequence:CCGGCGATCAGATCAAGATCCTGATCTCGAGATCAGGATCTTGATCTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018119.2-2456s21c1
Sequence:CCGGGGGTCAGCTTAAGTTAGTTAGCTCGAGCTAACTAACTTAAGCTGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-648s21c1
Sequence:CCGGTGAGGCGGAAGACGATGTTAACTCGAGTTAACATCGTCTTCCGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-1134s21c1
Sequence:CCGGGGTGAAGAGTGACATCCTATACTCGAGTATAGGATGTCACTCTTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-478s21c1
Sequence:CCGGACCAGTAACACATCCCGTTATCTCGAGATAACGGGATGTGTTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018119
VALIDATED
POLR3E MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-263s21c1
Sequence:CCGGCGATGACCTACGATGACATTCCTCGAGGAATGTCATCGTAGGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-1212s1c1
Sequence:CCGGCCGAGACTTCGTTATGTGGAACTCGAGTTCCACATAACGAAGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-355s1c1
Sequence:CCGGCCCAACTATTGCCGCAGCAAACTCGAGTTTGCTGCGGCAATAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-1858s1c1
Sequence:CCGGGCCACCTTTCAGAGACAGTTTCTCGAGAAACTGTCTCTGAAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-2194s1c1
Sequence:CCGGCTCAGTAAACAGGAGGTGGATCTCGAGATCCACCTCCTGTTTACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-993s1c1
Sequence:CCGGCGATCAGATCAAGATCCTGATCTCGAGATCAGGATCTTGATCTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018119.2-2456s21c1
Sequence:CCGGGGGTCAGCTTAAGTTAGTTAGCTCGAGCTAACTAACTTAAGCTGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-648s21c1
Sequence:CCGGTGAGGCGGAAGACGATGTTAACTCGAGTTAACATCGTCTTCCGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-1134s21c1
Sequence:CCGGGGTGAAGAGTGACATCCTATACTCGAGTATAGGATGTCACTCTTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-478s21c1
Sequence:CCGGACCAGTAACACATCCCGTTATCTCGAGATAACGGGATGTGTTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018119
VALIDATED
POLR3E MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-263s21c1
Sequence:CCGGCGATGACCTACGATGACATTCCTCGAGGAATGTCATCGTAGGTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-1212s1c1
Sequence:CCGGCCGAGACTTCGTTATGTGGAACTCGAGTTCCACATAACGAAGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-355s1c1
Sequence:CCGGCCCAACTATTGCCGCAGCAAACTCGAGTTTGCTGCGGCAATAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-1858s1c1
Sequence:CCGGGCCACCTTTCAGAGACAGTTTCTCGAGAAACTGTCTCTGAAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-2194s1c1
Sequence:CCGGCTCAGTAAACAGGAGGTGGATCTCGAGATCCACCTCCTGTTTACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_018119.2-993s1c1
Sequence:CCGGCGATCAGATCAAGATCCTGATCTCGAGATCAGGATCTTGATCTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018119.2-2456s21c1
Sequence:CCGGGGGTCAGCTTAAGTTAGTTAGCTCGAGCTAACTAACTTAAGCTGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-648s21c1
Sequence:CCGGTGAGGCGGAAGACGATGTTAACTCGAGTTAACATCGTCTTCCGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-1134s21c1
Sequence:CCGGGGTGAAGAGTGACATCCTATACTCGAGTATAGGATGTCACTCTTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018119.2-478s21c1
Sequence:CCGGACCAGTAACACATCCCGTTATCTCGAGATAACGGGATGTGTTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025298
VALIDATED
POLR3E MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-718s1c1
Sequence:CCGGCGTGCAGTCCTATGAGTTCTTCTCGAGAAGAACTCATAGGACTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025298.2-2824s1c1
Sequence:CCGGCGGTCTCAACTGTTTACACAACTCGAGTTGTGTAAACAGTTGAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025298.2-1207s1c1
Sequence:CCGGCCGAGACTTTGTTATGTGGAACTCGAGTTCCACATAACAAAGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-350s1c1
Sequence:CCGGCCCAACTACTGCCGCAGCAAACTCGAGTTTGCTGCGGCAGTAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-1421s21c1
Sequence:CCGGTCGGGCATCCAGGCCAAATTACTCGAGTAATTTGGCCTGGATGCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-718s21c1
Sequence:CCGGCGTGCAGTCCTATGAGTTCTTCTCGAGAAGAACTCATAGGACTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025298.2-2491s21c1
Sequence:CCGGGGCCTTCTTTGCAGTACAATTCTCGAGAATTGTACTGCAAAGAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-215s1c1
Sequence:CCGGGCAGAGAAGCTGTATCTCTTTCTCGAGAAAGAGATACAGCTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-215s21c1
Sequence:CCGGGCAGAGAAGCTGTATCTCTTTCTCGAGAAAGAGATACAGCTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-2049s21c1
Sequence:CCGGCTGATGAGCAGAAGGTATTTGCTCGAGCAAATACCTTCTGCTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025298
VALIDATED
POLR3E MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-718s1c1
Sequence:CCGGCGTGCAGTCCTATGAGTTCTTCTCGAGAAGAACTCATAGGACTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025298.2-2824s1c1
Sequence:CCGGCGGTCTCAACTGTTTACACAACTCGAGTTGTGTAAACAGTTGAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025298.2-1207s1c1
Sequence:CCGGCCGAGACTTTGTTATGTGGAACTCGAGTTCCACATAACAAAGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-350s1c1
Sequence:CCGGCCCAACTACTGCCGCAGCAAACTCGAGTTTGCTGCGGCAGTAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-1421s21c1
Sequence:CCGGTCGGGCATCCAGGCCAAATTACTCGAGTAATTTGGCCTGGATGCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-718s21c1
Sequence:CCGGCGTGCAGTCCTATGAGTTCTTCTCGAGAAGAACTCATAGGACTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025298.2-2491s21c1
Sequence:CCGGGGCCTTCTTTGCAGTACAATTCTCGAGAATTGTACTGCAAAGAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-215s1c1
Sequence:CCGGGCAGAGAAGCTGTATCTCTTTCTCGAGAAAGAGATACAGCTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-215s21c1
Sequence:CCGGGCAGAGAAGCTGTATCTCTTTCTCGAGAAAGAGATACAGCTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-2049s21c1
Sequence:CCGGCTGATGAGCAGAAGGTATTTGCTCGAGCAAATACCTTCTGCTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025298
VALIDATED
POLR3E MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-718s1c1
Sequence:CCGGCGTGCAGTCCTATGAGTTCTTCTCGAGAAGAACTCATAGGACTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025298.2-2824s1c1
Sequence:CCGGCGGTCTCAACTGTTTACACAACTCGAGTTGTGTAAACAGTTGAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025298.2-1207s1c1
Sequence:CCGGCCGAGACTTTGTTATGTGGAACTCGAGTTCCACATAACAAAGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-350s1c1
Sequence:CCGGCCCAACTACTGCCGCAGCAAACTCGAGTTTGCTGCGGCAGTAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-1421s21c1
Sequence:CCGGTCGGGCATCCAGGCCAAATTACTCGAGTAATTTGGCCTGGATGCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-718s21c1
Sequence:CCGGCGTGCAGTCCTATGAGTTCTTCTCGAGAAGAACTCATAGGACTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025298.2-2491s21c1
Sequence:CCGGGGCCTTCTTTGCAGTACAATTCTCGAGAATTGTACTGCAAAGAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025298.2-215s1c1
Sequence:CCGGGCAGAGAAGCTGTATCTCTTTCTCGAGAAAGAGATACAGCTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-215s21c1
Sequence:CCGGGCAGAGAAGCTGTATCTCTTTCTCGAGAAAGAGATACAGCTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025298.2-2049s21c1
Sequence:CCGGCTGATGAGCAGAAGGTATTTGCTCGAGCAAATACCTTCTGCTCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)