EMAIL THIS PAGE TO A FRIEND

POLR3F

polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa

83 Gene Product Result for
Synonyms: RPC39 RPC6
UniProtKB ID: Q9H1D9, A8K4C7, O15319
Gene ID:
Human(10621) Summary: The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. [provided by RefSeq, Jul 2008]
Mouse(70408) polymerase (RNA) III (DNA directed) polypeptide F
Rat(311487) polymerase (RNA) III (DNA directed) polypeptide F
cow(529410) polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
sheep(101121955) polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
naked mole-rat(101718400) polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
domestic guinea pig(100723851) polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Zebrafish(394162) polymerase (RNA) III (DNA directed) polypeptide F
chicken(416723) polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
dog(477143) polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
domestic cat(101100880) polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006466 Rosetta Predictions human pricing
NM_001107784 Rosetta Predictions rat pricing
NM_029763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133409 predicted 723
2 SASI_Hs01_00133410 predicted 411
3 SASI_Hs01_00133411 predicted 650
4 SASI_Hs01_00133412 predicted 788
5 SASI_Hs01_00133413 predicted 902
6 SASI_Hs01_00133414 predicted 284
7 SASI_Hs01_00133415 predicted 427
8 SASI_Hs01_00133416 predicted 762
9 SASI_Hs01_00133418 predicted 458
10 SASI_Hs02_00341625 predicted 691
11 SASI_Hs01_00133417 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232235 predicted 514
2 SASI_Rn02_00232236 predicted 585
3 SASI_Rn02_00232237 predicted 807
4 SASI_Rn02_00232238 predicted 1096
5 SASI_Rn02_00232239 predicted 909
6 SASI_Rn02_00232240 predicted 436
7 SASI_Rn02_00232241 predicted 813
8 SASI_Rn02_00232242 predicted 558
9 SASI_Rn02_00232243 predicted 566
10 SASI_Rn02_00232244 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335899 predicted 757
2 SASI_Mm02_00335900 predicted 411
3 SASI_Mm02_00335901 predicted 1149
4 SASI_Mm02_00335902 predicted 1123
5 SASI_Mm02_00335903 predicted 235
6 SASI_Mm02_00335904 predicted 1009
7 SASI_Mm02_00335905 predicted 473
8 SASI_Mm02_00335906 predicted 1004
9 SASI_Mm02_00335907 predicted 1018
10 SASI_Mm02_00335908 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006466
POLR3F MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-779s21c1
Sequence:CCGGTGCGAATTGGGAATCAGTAAGCTCGAGCTTACTGATTCCCAATTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006466.2-1367s21c1
Sequence:CCGGATGCCAACATACCCGTATTTACTCGAGTAAATACGGGTATGTTGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-375s21c1
Sequence:CCGGAGGGATCCGATAACCAAGAAACTCGAGTTTCTTGGTTATCGGATCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-828s1c1
Sequence:CCGGCCATCCTGAATACACTCATTTCTCGAGAAATGAGTGTATTCAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-276s1c1
Sequence:CCGGCCATCAATAGGTTGTTGTCTACTCGAGTAGACAACAACCTATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-865s1c1
Sequence:CCGGGATGACGATTATTGCTGCAAACTCGAGTTTGCAGCAATAATCGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-639s1c1
Sequence:CCGGCTGAATTTGTAGAGGTGCTTACTCGAGTAAGCACCTCTACAAATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-232s1c1
Sequence:CCGGTCAGAATGAAATGCCTCATATCTCGAGATATGAGGCATTTCATTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-559s21c1
Sequence:CCGGGAAGGTGTATATGCTCTATAACTCGAGTTATAGAGCATATACACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-298s21c1
Sequence:CCGGGGGTCAGTTGGATCTCTTAAGCTCGAGCTTAAGAGATCCAACTGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-903s21c1
Sequence:CCGGGTGTAGATGGACACATGAAACCTCGAGGTTTCATGTGTCCATCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006466
POLR3F MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-779s21c1
Sequence:CCGGTGCGAATTGGGAATCAGTAAGCTCGAGCTTACTGATTCCCAATTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006466.2-1367s21c1
Sequence:CCGGATGCCAACATACCCGTATTTACTCGAGTAAATACGGGTATGTTGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-375s21c1
Sequence:CCGGAGGGATCCGATAACCAAGAAACTCGAGTTTCTTGGTTATCGGATCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-828s1c1
Sequence:CCGGCCATCCTGAATACACTCATTTCTCGAGAAATGAGTGTATTCAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-276s1c1
Sequence:CCGGCCATCAATAGGTTGTTGTCTACTCGAGTAGACAACAACCTATTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-865s1c1
Sequence:CCGGGATGACGATTATTGCTGCAAACTCGAGTTTGCAGCAATAATCGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-639s1c1
Sequence:CCGGCTGAATTTGTAGAGGTGCTTACTCGAGTAAGCACCTCTACAAATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-232s1c1
Sequence:CCGGTCAGAATGAAATGCCTCATATCTCGAGATATGAGGCATTTCATTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-559s21c1
Sequence:CCGGGAAGGTGTATATGCTCTATAACTCGAGTTATAGAGCATATACACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-298s21c1
Sequence:CCGGGGGTCAGTTGGATCTCTTAAGCTCGAGCTTAAGAGATCCAACTGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-903s21c1
Sequence:CCGGGTGTAGATGGACACATGAAACCTCGAGGTTTCATGTGTCCATCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006466
POLR3F MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-779s21c1
Sequence:CCGGTGCGAATTGGGAATCAGTAAGCTCGAGCTTACTGATTCCCAATTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006466.2-1367s21c1
Sequence:CCGGATGCCAACATACCCGTATTTACTCGAGTAAATACGGGTATGTTGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-375s21c1
Sequence:CCGGAGGGATCCGATAACCAAGAAACTCGAGTTTCTTGGTTATCGGATCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-828s1c1
Sequence:CCGGCCATCCTGAATACACTCATTTCTCGAGAAATGAGTGTATTCAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-276s1c1
Sequence:CCGGCCATCAATAGGTTGTTGTCTACTCGAGTAGACAACAACCTATTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-865s1c1
Sequence:CCGGGATGACGATTATTGCTGCAAACTCGAGTTTGCAGCAATAATCGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-639s1c1
Sequence:CCGGCTGAATTTGTAGAGGTGCTTACTCGAGTAAGCACCTCTACAAATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006466.2-232s1c1
Sequence:CCGGTCAGAATGAAATGCCTCATATCTCGAGATATGAGGCATTTCATTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-559s21c1
Sequence:CCGGGAAGGTGTATATGCTCTATAACTCGAGTTATAGAGCATATACACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-298s21c1
Sequence:CCGGGGGTCAGTTGGATCTCTTAAGCTCGAGCTTAAGAGATCCAACTGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006466.2-903s21c1
Sequence:CCGGGTGTAGATGGACACATGAAACCTCGAGGTTTCATGTGTCCATCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027417
POLR3F MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-374s1c1
Sequence:CCGGGTCTATCAAATCATAGAGGATCTCGAGATCCTCTATGATTTGATAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-205s1c1
Sequence:CCGGTCAGAACGAAATGCCTCACATCTCGAGATGTGAGGCATTTCGTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-206s1c1
Sequence:CCGGCAGAACGAAATGCCTCACATTCTCGAGAATGTGAGGCATTTCGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027417.1-919s1c1
Sequence:CCGGCCCTTAGTTTATGTGGGATTTCTCGAGAAATCCCACATAAACTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-300s1c1
Sequence:CCGGCAGGCCTCTTATATAGAATAACTCGAGTTATTCTATATAAGAGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027417
POLR3F MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-374s1c1
Sequence:CCGGGTCTATCAAATCATAGAGGATCTCGAGATCCTCTATGATTTGATAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-205s1c1
Sequence:CCGGTCAGAACGAAATGCCTCACATCTCGAGATGTGAGGCATTTCGTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-206s1c1
Sequence:CCGGCAGAACGAAATGCCTCACATTCTCGAGAATGTGAGGCATTTCGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027417.1-919s1c1
Sequence:CCGGCCCTTAGTTTATGTGGGATTTCTCGAGAAATCCCACATAAACTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-300s1c1
Sequence:CCGGCAGGCCTCTTATATAGAATAACTCGAGTTATTCTATATAAGAGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027417
POLR3F MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-374s1c1
Sequence:CCGGGTCTATCAAATCATAGAGGATCTCGAGATCCTCTATGATTTGATAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-205s1c1
Sequence:CCGGTCAGAACGAAATGCCTCACATCTCGAGATGTGAGGCATTTCGTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-206s1c1
Sequence:CCGGCAGAACGAAATGCCTCACATTCTCGAGAATGTGAGGCATTTCGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027417.1-919s1c1
Sequence:CCGGCCCTTAGTTTATGTGGGATTTCTCGAGAAATCCCACATAAACTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027417.1-300s1c1
Sequence:CCGGCAGGCCTCTTATATAGAATAACTCGAGTTATTCTATATAAGAGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)