EMAIL THIS PAGE TO A FRIEND

POLRMT

polymerase (RNA) mitochondrial (DNA directed)

45 Gene Product Result for
Synonyms: APOLMT MTRNAP MTRPOL h-mtRPOL
UniProtKB ID: O00411, O60370
Gene ID:
Human(5442) Summary: This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of phage and mitochondrial polymerases of lower eukaryotes. [provided by RefSeq, Jul 2008]
Mouse(216151) polymerase (RNA) mitochondrial (DNA directed)
Rat(299604) polymerase (RNA) mitochondrial (DNA directed)
Zebrafish(557066) polymerase (RNA) mitochondrial (DNA directed)
domestic cat(101091259) polymerase (RNA) mitochondrial (DNA directed)
dog(485102) polymerase (RNA) mitochondrial (DNA directed)
chicken(420084) polymerase (RNA) mitochondrial (DNA directed)
domestic guinea pig(100723303) polymerase (RNA) mitochondrial (DNA directed)
naked mole-rat(101721232) polymerase (RNA) mitochondrial (DNA directed)
cow(504757) polymerase (RNA) mitochondrial (DNA directed)
sheep(101108748) polymerase (RNA) mitochondrial (DNA directed)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005035 Rosetta Predictions human pricing
NM_001106766 Rosetta Predictions rat pricing
NM_172551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338824 predicted 3561
2 SASI_Hs01_00080206 predicted 994
3 SASI_Hs02_00338825 predicted 3315
4 SASI_Hs01_00080207 predicted 1156
5 SASI_Hs01_00080208 predicted 3348
6 SASI_Hs01_00080209 predicted 1558
7 SASI_Hs01_00080210 predicted 884
8 SASI_Hs01_00080211 predicted 1418
9 SASI_Hs01_00080212 predicted 1843
10 SASI_Hs01_00080214 predicted 2681
11 SASI_Hs01_00080213 predicted 1967
12 SASI_Hs01_00080215 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222188 predicted 3166
2 SASI_Rn02_00222189 predicted 3415
3 SASI_Rn02_00222190 predicted 2264
4 SASI_Rn02_00222191 predicted 2991
5 SASI_Rn02_00222192 predicted 1716
6 SASI_Rn02_00222193 predicted 426
7 SASI_Rn02_00222194 predicted 1357
8 SASI_Rn02_00222195 predicted 1207
9 SASI_Rn02_00222196 predicted 3008
10 SASI_Rn02_00222197 predicted 3302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344162 predicted 3246
2 SASI_Mm02_00344163 predicted 1421
3 SASI_Mm02_00344164 predicted 3414
4 SASI_Mm02_00344165 predicted 604
5 SASI_Mm02_00344166 predicted 1214
6 SASI_Mm02_00344167 predicted 1487
7 SASI_Mm02_00344168 predicted 3018
8 SASI_Mm02_00344169 predicted 3171
9 SASI_Mm02_00344170 predicted 2102
10 SASI_Mm02_00344171 predicted 1750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172551
VALIDATED
POLRMT MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) mitochondrial (DNA directed)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-1744s1c1
Sequence:CCGGCCCAGTGCTTTACCATGTGTACTCGAGTACACATGGTAAAGCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-3514s1c1
Sequence:CCGGGTCCAGCATCAAGTCCCTAAACTCGAGTTTAGGGACTTGATGCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-2086s1c1
Sequence:CCGGGCTGCAGATCTTTAGAGACAACTCGAGTTGTCTCTAAAGATCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172551.1-1745s1c1
Sequence:CCGGCCAGTGCTTTACCATGTGTATCTCGAGATACACATGGTAAAGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-1426s1c1
Sequence:CCGGCCTTATCCAGTTGGCCCATAACTCGAGTTATGGGCCAACTGGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172551
VALIDATED
POLRMT MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) mitochondrial (DNA directed)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-1744s1c1
Sequence:CCGGCCCAGTGCTTTACCATGTGTACTCGAGTACACATGGTAAAGCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-3514s1c1
Sequence:CCGGGTCCAGCATCAAGTCCCTAAACTCGAGTTTAGGGACTTGATGCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-2086s1c1
Sequence:CCGGGCTGCAGATCTTTAGAGACAACTCGAGTTGTCTCTAAAGATCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172551.1-1745s1c1
Sequence:CCGGCCAGTGCTTTACCATGTGTATCTCGAGATACACATGGTAAAGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-1426s1c1
Sequence:CCGGCCTTATCCAGTTGGCCCATAACTCGAGTTATGGGCCAACTGGATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172551
VALIDATED
POLRMT MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) mitochondrial (DNA directed)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-1744s1c1
Sequence:CCGGCCCAGTGCTTTACCATGTGTACTCGAGTACACATGGTAAAGCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-3514s1c1
Sequence:CCGGGTCCAGCATCAAGTCCCTAAACTCGAGTTTAGGGACTTGATGCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-2086s1c1
Sequence:CCGGGCTGCAGATCTTTAGAGACAACTCGAGTTGTCTCTAAAGATCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172551.1-1745s1c1
Sequence:CCGGCCAGTGCTTTACCATGTGTATCTCGAGATACACATGGTAAAGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172551.1-1426s1c1
Sequence:CCGGCCTTATCCAGTTGGCCCATAACTCGAGTTATGGGCCAACTGGATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005035
VALIDATED
POLRMT MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) mitochondrial (DNA directed)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-1610s1c1
Sequence:CCGGGCAGAACCACTACAGGAAGTACTCGAGTACTTCCTGTAGTGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-1960s1c1
Sequence:CCGGCGGTGGATGTACCCATGCTTTCTCGAGAAAGCATGGGTACATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-3285s1c1
Sequence:CCGGGACTCCAAGGTCAAGCAAATACTCGAGTATTTGCTTGACCTTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-395s1c1
Sequence:CCGGCTGGGCAAAGATACTGGAGAACTCGAGTTCTCCAGTATCTTTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-3132s1c1
Sequence:CCGGCGCCAGGTCTTCAAGAGTCTACTCGAGTAGACTCTTGAAGACCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005035.3-1867s21c1
Sequence:CCGGCCGTGCTCTACCACGTGTATTCTCGAGAATACACGTGGTAGAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005035.3-1634s21c1
Sequence:CCGGGCAGAACCACTACAGGAAGTACTCGAGTACTTCCTGTAGTGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005035.3-3309s21c1
Sequence:CCGGGACTCCAAGGTCAAGCAAATACTCGAGTATTTGCTTGACCTTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005035.3-1984s21c1
Sequence:CCGGCGGTGGATGTACCCATGCTTTCTCGAGAAAGCATGGGTACATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005035
VALIDATED
POLRMT MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) mitochondrial (DNA directed)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-1610s1c1
Sequence:CCGGGCAGAACCACTACAGGAAGTACTCGAGTACTTCCTGTAGTGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-1960s1c1
Sequence:CCGGCGGTGGATGTACCCATGCTTTCTCGAGAAAGCATGGGTACATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-3285s1c1
Sequence:CCGGGACTCCAAGGTCAAGCAAATACTCGAGTATTTGCTTGACCTTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-395s1c1
Sequence:CCGGCTGGGCAAAGATACTGGAGAACTCGAGTTCTCCAGTATCTTTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-3132s1c1
Sequence:CCGGCGCCAGGTCTTCAAGAGTCTACTCGAGTAGACTCTTGAAGACCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005035.3-1867s21c1
Sequence:CCGGCCGTGCTCTACCACGTGTATTCTCGAGAATACACGTGGTAGAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005035.3-1634s21c1
Sequence:CCGGGCAGAACCACTACAGGAAGTACTCGAGTACTTCCTGTAGTGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005035.3-3309s21c1
Sequence:CCGGGACTCCAAGGTCAAGCAAATACTCGAGTATTTGCTTGACCTTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005035.3-1984s21c1
Sequence:CCGGCGGTGGATGTACCCATGCTTTCTCGAGAAAGCATGGGTACATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005035
VALIDATED
POLRMT MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) mitochondrial (DNA directed)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-1610s1c1
Sequence:CCGGGCAGAACCACTACAGGAAGTACTCGAGTACTTCCTGTAGTGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-1960s1c1
Sequence:CCGGCGGTGGATGTACCCATGCTTTCTCGAGAAAGCATGGGTACATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-3285s1c1
Sequence:CCGGGACTCCAAGGTCAAGCAAATACTCGAGTATTTGCTTGACCTTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-395s1c1
Sequence:CCGGCTGGGCAAAGATACTGGAGAACTCGAGTTCTCCAGTATCTTTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005035.2-3132s1c1
Sequence:CCGGCGCCAGGTCTTCAAGAGTCTACTCGAGTAGACTCTTGAAGACCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005035.3-1867s21c1
Sequence:CCGGCCGTGCTCTACCACGTGTATTCTCGAGAATACACGTGGTAGAGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005035.3-1634s21c1
Sequence:CCGGGCAGAACCACTACAGGAAGTACTCGAGTACTTCCTGTAGTGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005035.3-3309s21c1
Sequence:CCGGGACTCCAAGGTCAAGCAAATACTCGAGTATTTGCTTGACCTTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005035.3-1984s21c1
Sequence:CCGGCGGTGGATGTACCCATGCTTTCTCGAGAAAGCATGGGTACATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)