EMAIL THIS PAGE TO A FRIEND

POM121

POM121 transmembrane nucleoporin

44 Gene Product Result for
Synonyms: P145 POM121A
Gene ID:
Human(9883) Summary: The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. This gene encodes a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is an integral membrane protein that localizes to the central spoke ring complex and participates in anchoring the nuclear pore complex to the nuclear envelope. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and multiple pseudogenes have been identified. [provided by RefSeq, Mar 2012]
Mouse(107939) nuclear pore membrane protein 121
Rat(113975) POM121 transmembrane nucleoporin
Zebrafish(568298) POM121 membrane glycoprotein (rat)
chicken(417463) POM121 transmembrane nucleoporin
domestic cat(101092160) POM121 transmembrane nucleoporin
dog(489812) POM121 transmembrane nucleoporin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700248 Anti-POM121 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503723 Anti-POM121 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172020 Rosetta Predictions human pricing
NM_053622 Rosetta Predictions rat pricing
NM_148932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367777 predicted 1470
2 SASI_Hs01_00179283 predicted 1320
3 SASI_Hs01_00179284 predicted 1966
4 SASI_Hs01_00179285 predicted 2814
5 SASI_Hs01_00179280 predicted 3807
6 SASI_Hs02_00367778 predicted 1802
7 SASI_Hs01_00179286 predicted 1315
8 SASI_Hs01_00179287 predicted 1410
9 SASI_Hs01_00179288 predicted 1790
10 SASI_Hs01_00179289 predicted 3675
11 SASI_Hs01_00179281 predicted 3374
12 SASI_Hs01_00179282 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106761 predicted 569
2 SASI_Rn01_00106762 predicted 614
3 SASI_Rn01_00106763 predicted 2410
4 SASI_Rn01_00106764 predicted 1564
5 SASI_Rn01_00106765 predicted 1698
6 SASI_Rn01_00106766 predicted 2406
7 SASI_Rn01_00106767 predicted 1708
8 SASI_Rn01_00106768 predicted 2118
9 SASI_Rn01_00106769 predicted 698
10 SASI_Rn01_00106770 predicted 2493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078349 predicted 796
2 SASI_Mm01_00078350 predicted 3636
3 SASI_Mm01_00078351 predicted 651
4 SASI_Mm01_00078352 predicted 3409
5 SASI_Mm01_00078353 predicted 610
6 SASI_Mm01_00078354 predicted 1100
7 SASI_Mm02_00342743 predicted 3268
8 SASI_Mm01_00078356 predicted 662
9 SASI_Mm01_00078357 predicted 847
10 SASI_Mm01_00078358 predicted 1746
11 SASI_Mm01_00078355 predicted 2405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172020
VALIDATED
POM121 MISSION shRNA Bacterial Glycerol Stock
POM121 transmembrane nucleoporin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172020.1-3286s21c1
Sequence:CCGGACTCGGCGTTTGGGTTGAAAGCTCGAGCTTTCAACCCAAACGCCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172020.1-4352s21c1
Sequence:CCGGGGGCTATCCGTAAAGCTTTATCTCGAGATAAAGCTTTACGGATAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172020.1-4324s21c1
Sequence:CCGGGGTGTGCACCTGATGGGATTTCTCGAGAAATCCCATCAGGTGCACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-3018s1c1
Sequence:CCGGCCCACGTTCAACATTCCCTTTCTCGAGAAAGGGAATGTTGAACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1098s1c1
Sequence:CCGGCCATGTGCAAAGGAGACAGTACTCGAGTACTGTCTCCTTTGCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1477s1c1
Sequence:CCGGCCAGTTCATCACCCTTCTCTACTCGAGTAGAGAAGGGTGATGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1967s1c1
Sequence:CCGGCCCACTGTTAGAGAGCTTGAACTCGAGTTCAAGCTCTCTAACAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172020
VALIDATED
POM121 MISSION shRNA shRNA Plasmid DNA
POM121 transmembrane nucleoporin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172020.1-3286s21c1
Sequence:CCGGACTCGGCGTTTGGGTTGAAAGCTCGAGCTTTCAACCCAAACGCCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172020.1-4352s21c1
Sequence:CCGGGGGCTATCCGTAAAGCTTTATCTCGAGATAAAGCTTTACGGATAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172020.1-4324s21c1
Sequence:CCGGGGTGTGCACCTGATGGGATTTCTCGAGAAATCCCATCAGGTGCACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-3018s1c1
Sequence:CCGGCCCACGTTCAACATTCCCTTTCTCGAGAAAGGGAATGTTGAACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1098s1c1
Sequence:CCGGCCATGTGCAAAGGAGACAGTACTCGAGTACTGTCTCCTTTGCACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1477s1c1
Sequence:CCGGCCAGTTCATCACCCTTCTCTACTCGAGTAGAGAAGGGTGATGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1967s1c1
Sequence:CCGGCCCACTGTTAGAGAGCTTGAACTCGAGTTCAAGCTCTCTAACAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172020
VALIDATED
POM121 MISSION shRNA Lentiviral Transduction Particles
POM121 transmembrane nucleoporin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172020.1-3286s21c1
Sequence:CCGGACTCGGCGTTTGGGTTGAAAGCTCGAGCTTTCAACCCAAACGCCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172020.1-4352s21c1
Sequence:CCGGGGGCTATCCGTAAAGCTTTATCTCGAGATAAAGCTTTACGGATAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172020.1-4324s21c1
Sequence:CCGGGGTGTGCACCTGATGGGATTTCTCGAGAAATCCCATCAGGTGCACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-3018s1c1
Sequence:CCGGCCCACGTTCAACATTCCCTTTCTCGAGAAAGGGAATGTTGAACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1098s1c1
Sequence:CCGGCCATGTGCAAAGGAGACAGTACTCGAGTACTGTCTCCTTTGCACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1477s1c1
Sequence:CCGGCCAGTTCATCACCCTTCTCTACTCGAGTAGAGAAGGGTGATGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172020.1-1967s1c1
Sequence:CCGGCCCACTGTTAGAGAGCTTGAACTCGAGTTCAAGCTCTCTAACAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148932
VALIDATED
POM121 MISSION shRNA Bacterial Glycerol Stock
POM121 transmembrane nucleoporin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-795s21c1
Sequence:CCGGCCTCCAGACAGCAAGCTATTCCTCGAGGAATAGCTTGCTGTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-1944s21c1
Sequence:CCGGCTGGCTTCTGCTTCGTCTATACTCGAGTATAGACGAAGCAGAAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148932.2-665s21c1
Sequence:CCGGCATTCAGCAAGCCCAGTATTCCTCGAGGAATACTGGGCTTGCTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-4499s21c1
Sequence:CCGGTGTTGGTAATGCCGGACTTAACTCGAGTTAAGTCCGGCATTACCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-3423s21c1
Sequence:CCGGGGCACATCTACACCTACTTTCCTCGAGGAAAGTAGGTGTAGATGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148932
VALIDATED
POM121 MISSION shRNA shRNA Plasmid DNA
POM121 transmembrane nucleoporin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-795s21c1
Sequence:CCGGCCTCCAGACAGCAAGCTATTCCTCGAGGAATAGCTTGCTGTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-1944s21c1
Sequence:CCGGCTGGCTTCTGCTTCGTCTATACTCGAGTATAGACGAAGCAGAAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148932.2-665s21c1
Sequence:CCGGCATTCAGCAAGCCCAGTATTCCTCGAGGAATACTGGGCTTGCTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-4499s21c1
Sequence:CCGGTGTTGGTAATGCCGGACTTAACTCGAGTTAAGTCCGGCATTACCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-3423s21c1
Sequence:CCGGGGCACATCTACACCTACTTTCCTCGAGGAAAGTAGGTGTAGATGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148932
VALIDATED
POM121 MISSION shRNA Lentiviral Transduction Particles
POM121 transmembrane nucleoporin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-795s21c1
Sequence:CCGGCCTCCAGACAGCAAGCTATTCCTCGAGGAATAGCTTGCTGTCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-1944s21c1
Sequence:CCGGCTGGCTTCTGCTTCGTCTATACTCGAGTATAGACGAAGCAGAAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148932.2-665s21c1
Sequence:CCGGCATTCAGCAAGCCCAGTATTCCTCGAGGAATACTGGGCTTGCTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-4499s21c1
Sequence:CCGGTGTTGGTAATGCCGGACTTAACTCGAGTTAAGTCCGGCATTACCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_148932.2-3423s21c1
Sequence:CCGGGGCACATCTACACCTACTTTCCTCGAGGAAAGTAGGTGTAGATGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)