EMAIL THIS PAGE TO A FRIEND

POM121L12

POM121 transmembrane nucleoporin-like 12

28 Gene Product Result for
UniProtKB ID: Q8N7R1, Q8NDI9
Gene ID:
Mouse(432536) POM121 membrane glycoprotein-like 12
Rat(100361125) POM121 transmembrane nucleoporin-like 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182595 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182595 Rosetta Predictions human pricing
NR_002893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039955 predicted 934
2 SASI_Hs01_00039957 predicted 993
3 SASI_Hs01_00039958 predicted 988
4 SASI_Hs01_00039959 predicted 944
5 SASI_Hs01_00039960 predicted 984
6 SASI_Hs01_00039961 predicted 802
7 SASI_Hs01_00039962 predicted 935
8 SASI_Hs01_00039963 predicted 915
9 SASI_Hs01_00039964 predicted 990
10 SASI_Hs02_00370736 predicted 946
11 SASI_Hs01_00039956 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353041 predicted 780
2 SASI_Mm02_00353042 predicted 513
3 SASI_Mm02_00353043 predicted 463
4 SASI_Mm02_00353044 predicted 239
5 SASI_Mm02_00353045 predicted 814
6 SASI_Mm02_00353046 predicted 439
7 SASI_Mm02_00353047 predicted 590
8 SASI_Mm02_00353048 predicted 505
9 SASI_Mm02_00353049 predicted 496
10 SASI_Mm02_00353050 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164166
POM121L12 MISSION shRNA Bacterial Glycerol Stock
POM121 transmembrane nucleoporin-like 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164166.1-906s21c1
Sequence:CCGGTGCAATACTTGCTTCACCTACCTCGAGGTAGGTGAAGCAAGTATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-272s21c1
Sequence:CCGGCTATATGAAACGATGGATTTGCTCGAGCAAATCCATCGTTTCATATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-548s21c1
Sequence:CCGGTAAGCGTTCTTCAGCCTTTAACTCGAGTTAAAGGCTGAAGAACGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-892s21c1
Sequence:CCGGAGCCCAGTTTGGGTTGCAATACTCGAGTATTGCAACCCAAACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-257s21c1
Sequence:CCGGCAGTGCCTGGGACACCTATATCTCGAGATATAGGTGTCCCAGGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164166
POM121L12 MISSION shRNA shRNA Plasmid DNA
POM121 transmembrane nucleoporin-like 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164166.1-906s21c1
Sequence:CCGGTGCAATACTTGCTTCACCTACCTCGAGGTAGGTGAAGCAAGTATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-272s21c1
Sequence:CCGGCTATATGAAACGATGGATTTGCTCGAGCAAATCCATCGTTTCATATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-548s21c1
Sequence:CCGGTAAGCGTTCTTCAGCCTTTAACTCGAGTTAAAGGCTGAAGAACGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-892s21c1
Sequence:CCGGAGCCCAGTTTGGGTTGCAATACTCGAGTATTGCAACCCAAACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-257s21c1
Sequence:CCGGCAGTGCCTGGGACACCTATATCTCGAGATATAGGTGTCCCAGGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164166
POM121L12 MISSION shRNA Lentiviral Transduction Particles
POM121 transmembrane nucleoporin-like 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164166.1-906s21c1
Sequence:CCGGTGCAATACTTGCTTCACCTACCTCGAGGTAGGTGAAGCAAGTATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-272s21c1
Sequence:CCGGCTATATGAAACGATGGATTTGCTCGAGCAAATCCATCGTTTCATATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-548s21c1
Sequence:CCGGTAAGCGTTCTTCAGCCTTTAACTCGAGTTAAAGGCTGAAGAACGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-892s21c1
Sequence:CCGGAGCCCAGTTTGGGTTGCAATACTCGAGTATTGCAACCCAAACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164166.1-257s21c1
Sequence:CCGGCAGTGCCTGGGACACCTATATCTCGAGATATAGGTGTCCCAGGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182595
POM121L12 MISSION shRNA Bacterial Glycerol Stock
POM121 transmembrane nucleoporin-like 12
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182595.2-945s1c1
Sequence:CCGGCCCACGTATCTACTTTCACTTCTCGAGAAGTGAAAGTAGATACGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.2-198s1c1
Sequence:CCGGGCCATATTGAGTACTTCCAGTCTCGAGACTGGAAGTACTCAATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.2-190s1c1
Sequence:CCGGGACTCAGAGCCATATTGAGTACTCGAGTACTCAATATGGCTCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.1-953s1c1
Sequence:CCGGCGGTTGCTTCCTTCGTGCCCACTCGAGTGGGCACGAAGGAAGCAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.1-862s1c1
Sequence:CCGGCCGTTGTGGTTCGAGGTCTCACTCGAGTGAGACCTCGAACCACAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182595.3-971s21c1
Sequence:CCGGTCCTTGCTCTACCTCAACGTGCTCGAGCACGTTGAGGTAGAGCAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182595
POM121L12 MISSION shRNA shRNA Plasmid DNA
POM121 transmembrane nucleoporin-like 12
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182595.2-945s1c1
Sequence:CCGGCCCACGTATCTACTTTCACTTCTCGAGAAGTGAAAGTAGATACGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.2-198s1c1
Sequence:CCGGGCCATATTGAGTACTTCCAGTCTCGAGACTGGAAGTACTCAATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.2-190s1c1
Sequence:CCGGGACTCAGAGCCATATTGAGTACTCGAGTACTCAATATGGCTCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.1-953s1c1
Sequence:CCGGCGGTTGCTTCCTTCGTGCCCACTCGAGTGGGCACGAAGGAAGCAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.1-862s1c1
Sequence:CCGGCCGTTGTGGTTCGAGGTCTCACTCGAGTGAGACCTCGAACCACAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182595.3-971s21c1
Sequence:CCGGTCCTTGCTCTACCTCAACGTGCTCGAGCACGTTGAGGTAGAGCAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182595
POM121L12 MISSION shRNA Lentiviral Transduction Particles
POM121 transmembrane nucleoporin-like 12
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182595.2-945s1c1
Sequence:CCGGCCCACGTATCTACTTTCACTTCTCGAGAAGTGAAAGTAGATACGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.2-198s1c1
Sequence:CCGGGCCATATTGAGTACTTCCAGTCTCGAGACTGGAAGTACTCAATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.2-190s1c1
Sequence:CCGGGACTCAGAGCCATATTGAGTACTCGAGTACTCAATATGGCTCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.1-953s1c1
Sequence:CCGGCGGTTGCTTCCTTCGTGCCCACTCGAGTGGGCACGAAGGAAGCAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182595.1-862s1c1
Sequence:CCGGCCGTTGTGGTTCGAGGTCTCACTCGAGTGAGACCTCGAACCACAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182595.3-971s21c1
Sequence:CCGGTCCTTGCTCTACCTCAACGTGCTCGAGCACGTTGAGGTAGAGCAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)