EMAIL THIS PAGE TO A FRIEND

POM121L2

POM121 transmembrane nucleoporin-like 2

98 Gene Product Result for
Synonyms: POM121-L POM121L
UniProtKB ID: Q96KW2
Gene ID:
Mouse(195236) POM121 membrane glycoprotein-like 2 (rat)
Rat(502128) POM121 transmembrane nucleoporin-like 2
domestic guinea pig(101788962) POM121 transmembrane nucleoporin-like 2
naked mole-rat(101724645) POM121 transmembrane nucleoporin-like 2
cow(100140439) POM121 membrane glycoprotein-like 2
sheep(101105288) POM121 transmembrane nucleoporin-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033482 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033482 Rosetta Predictions human pricing
XM_001715475 Rosetta Predictions human pricing
XM_001717703 Rosetta Predictions human pricing
XM_001718816 Rosetta Predictions human pricing
XM_001056851 Rosetta Predictions rat pricing
XM_001062193 Rosetta Predictions rat pricing
XM_111442 Rosetta Predictions mouse pricing
XR_035273 Rosetta Predictions mouse pricing
XR_035300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016405 predicted 504
2 SASI_Hs01_00016406 predicted 346
3 SASI_Hs01_00016407 predicted 2000
4 SASI_Hs01_00016408 predicted 1844
5 SASI_Hs01_00016409 predicted 1847
6 SASI_Hs01_00016410 predicted 1951
7 SASI_Hs01_00016411 predicted 1505
8 SASI_Hs01_00016412 predicted 2555
9 SASI_Hs01_00016413 predicted 2455
10 SASI_Hs01_00016414 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00403969 predicted 823
2 SASI_Hs02_00403970 predicted 2485
3 SASI_Hs02_00403971 predicted 2330
4 SASI_Hs02_00403972 predicted 2427
5 SASI_Hs02_00403973 predicted 1994
6 SASI_Hs02_00403974 predicted 3044
7 SASI_Hs02_00403975 predicted 2931
8 SASI_Hs02_00403976 predicted 839
9 SASI_Hs02_00403977 predicted 1926
10 SASI_Hs02_00403978 predicted 2550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00418852 predicted 829
2 SASI_Hs02_00418853 predicted 2481
3 SASI_Hs02_00418854 predicted 2331
4 SASI_Hs02_00418855 predicted 2427
5 SASI_Hs02_00418856 predicted 1987
6 SASI_Hs02_00418857 predicted 3040
7 SASI_Hs02_00418858 predicted 2930
8 SASI_Hs02_00418859 predicted 844
9 SASI_Hs02_00418860 predicted 1919
10 SASI_Hs02_00418861 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426486 predicted 285
2 SASI_Hs02_00426487 predicted 1940
3 SASI_Hs02_00426488 predicted 1795
4 SASI_Hs02_00426489 predicted 1892
5 SASI_Hs02_00426490 predicted 1445
6 SASI_Hs02_00426491 predicted 2498
7 SASI_Hs02_00426492 predicted 2397
8 SASI_Hs02_00426493 predicted 306
9 SASI_Hs02_00426494 predicted 1381
10 SASI_Hs02_00426495 predicted 2007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284668 predicted 1388
2 SASI_Rn02_00284669 predicted 1582
3 SASI_Rn02_00284670 predicted 1260
4 SASI_Rn02_00284671 predicted 428
5 SASI_Rn02_00284672 predicted 1682
6 SASI_Rn02_00284673 predicted 1738
7 SASI_Rn02_00284674 predicted 1764
8 SASI_Rn02_00284675 predicted 1176
9 SASI_Rn02_00284676 predicted 1423
10 SASI_Rn02_00284677 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302602 predicted 894
2 SASI_Rn02_00302603 predicted 1042
3 SASI_Rn02_00302604 predicted 994
4 SASI_Rn02_00302605 predicted 1393
5 SASI_Rn02_00302606 predicted 1576
6 SASI_Rn02_00302607 predicted 1256
7 SASI_Rn02_00302608 predicted 420
8 SASI_Rn02_00302609 predicted 794
9 SASI_Rn02_00302610 predicted 1681
10 SASI_Rn02_00302611 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_111442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215778 predicted 1320
2 SASI_Mm01_00215779 predicted 1292
3 SASI_Mm01_00215780 predicted 719
4 SASI_Mm01_00215781 predicted 1363
5 SASI_Mm01_00215782 predicted 1189
6 SASI_Mm01_00215783 predicted 1039
7 SASI_Mm01_00215784 predicted 1669
8 SASI_Mm01_00215785 predicted 770
9 SASI_Mm01_00215786 predicted 1269
10 SASI_Mm01_00215787 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481161 predicted 1024
2 SASI_Mm02_00481162 predicted 2928
3 SASI_Mm02_00481163 predicted 1087
4 SASI_Mm02_00481164 predicted 917
5 SASI_Mm02_00481165 predicted 1396
6 SASI_Mm02_00481166 predicted 2130
7 SASI_Mm02_00481167 predicted 2850
8 SASI_Mm02_00481168 predicted 2275
9 SASI_Mm02_00481169 predicted 1611
10 SASI_Mm02_00481170 predicted 2721
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481409 predicted 1019
2 SASI_Mm02_00481410 predicted 2932
3 SASI_Mm02_00481411 predicted 1086
4 SASI_Mm02_00481412 predicted 917
5 SASI_Mm02_00481413 predicted 1399
6 SASI_Mm02_00481414 predicted 2132
7 SASI_Mm02_00481415 predicted 2854
8 SASI_Mm02_00481416 predicted 2280
9 SASI_Mm02_00481417 predicted 1608
10 SASI_Mm02_00481418 predicted 2720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033482
POM121L2 MISSION shRNA Bacterial Glycerol Stock
POM121 transmembrane nucleoporin-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-2761s21c1
Sequence:CCGGGTGATGAGTCTGGGATCATAACTCGAGTTATGATCCCAGACTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-1880s21c1
Sequence:CCGGTCATGCTTCTACCCATCATTTCTCGAGAAATGATGGGTAGAAGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-357s21c1
Sequence:CCGGAGTTACTTAAAGCGGACTATTCTCGAGAATAGTCCGCTTTAAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-631s21c1
Sequence:CCGGAGACCAGACCATCGGCATTTACTCGAGTAAATGCCGATGGTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-2121s21c1
Sequence:CCGGCCACACCACCATCCTACAATTCTCGAGAATTGTAGGATGGTGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033482
POM121L2 MISSION shRNA shRNA Plasmid DNA
POM121 transmembrane nucleoporin-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-2761s21c1
Sequence:CCGGGTGATGAGTCTGGGATCATAACTCGAGTTATGATCCCAGACTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-1880s21c1
Sequence:CCGGTCATGCTTCTACCCATCATTTCTCGAGAAATGATGGGTAGAAGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-357s21c1
Sequence:CCGGAGTTACTTAAAGCGGACTATTCTCGAGAATAGTCCGCTTTAAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-631s21c1
Sequence:CCGGAGACCAGACCATCGGCATTTACTCGAGTAAATGCCGATGGTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-2121s21c1
Sequence:CCGGCCACACCACCATCCTACAATTCTCGAGAATTGTAGGATGGTGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033482
POM121L2 MISSION shRNA Lentiviral Transduction Particles
POM121 transmembrane nucleoporin-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-2761s21c1
Sequence:CCGGGTGATGAGTCTGGGATCATAACTCGAGTTATGATCCCAGACTCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-1880s21c1
Sequence:CCGGTCATGCTTCTACCCATCATTTCTCGAGAAATGATGGGTAGAAGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-357s21c1
Sequence:CCGGAGTTACTTAAAGCGGACTATTCTCGAGAATAGTCCGCTTTAAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-631s21c1
Sequence:CCGGAGACCAGACCATCGGCATTTACTCGAGTAAATGCCGATGGTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033482.3-2121s21c1
Sequence:CCGGCCACACCACCATCCTACAATTCTCGAGAATTGTAGGATGGTGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162929
POM121L2 MISSION shRNA Bacterial Glycerol Stock
POM121 transmembrane nucleoporin-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1304s21c1
Sequence:CCGGCCTAGGGACCTGCTAACTATACTCGAGTATAGTTAGCAGGTCCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1216s21c1
Sequence:CCGGAGCAGGAGAGAGTCCTAATTCCTCGAGGAATTAGGACTCTCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-925s21c1
Sequence:CCGGCTCCGTATGGTCCGCCTTTAACTCGAGTTAAAGGCGGACCATACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-659s21c1
Sequence:CCGGAGTTACCTGAAGCGTAATATTCTCGAGAATATTACGCTTCAGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1760s21c1
Sequence:CCGGGACAAGTCTCTTCCGTGATTCCTCGAGGAATCACGGAAGAGACTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162929
POM121L2 MISSION shRNA shRNA Plasmid DNA
POM121 transmembrane nucleoporin-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1304s21c1
Sequence:CCGGCCTAGGGACCTGCTAACTATACTCGAGTATAGTTAGCAGGTCCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1216s21c1
Sequence:CCGGAGCAGGAGAGAGTCCTAATTCCTCGAGGAATTAGGACTCTCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-925s21c1
Sequence:CCGGCTCCGTATGGTCCGCCTTTAACTCGAGTTAAAGGCGGACCATACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-659s21c1
Sequence:CCGGAGTTACCTGAAGCGTAATATTCTCGAGAATATTACGCTTCAGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1760s21c1
Sequence:CCGGGACAAGTCTCTTCCGTGATTCCTCGAGGAATCACGGAAGAGACTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162929
POM121L2 MISSION shRNA Lentiviral Transduction Particles
POM121 transmembrane nucleoporin-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1304s21c1
Sequence:CCGGCCTAGGGACCTGCTAACTATACTCGAGTATAGTTAGCAGGTCCCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1216s21c1
Sequence:CCGGAGCAGGAGAGAGTCCTAATTCCTCGAGGAATTAGGACTCTCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-925s21c1
Sequence:CCGGCTCCGTATGGTCCGCCTTTAACTCGAGTTAAAGGCGGACCATACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-659s21c1
Sequence:CCGGAGTTACCTGAAGCGTAATATTCTCGAGAATATTACGCTTCAGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162929.1-1760s21c1
Sequence:CCGGGACAAGTCTCTTCCGTGATTCCTCGAGGAATCACGGAAGAGACTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)