EMAIL THIS PAGE TO A FRIEND

POM121L8P

POM121 transmembrane nucleoporin-like 8 pseudogene

182 Gene Product Result for
Synonyms: DKFZp434K191
Species: Human POM121L8P(29797)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029950 Rosetta Predictions human pricing
XR_040035 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039551 predicted 3684
2 SASI_Hs01_00039552 predicted 3687
3 SASI_Hs01_00039553 predicted 3686
4 SASI_Hs01_00039554 predicted 3366
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515354 predicted 341
2 SASI_Hs02_00515355 predicted 330
3 SASI_Hs02_00515356 predicted 470
4 SASI_Hs02_00515357 predicted 459
5 SASI_Hs02_00515358 predicted 516
6 SASI_Hs02_00515359 predicted 509
7 SASI_Hs02_00515360 predicted 513
8 SASI_Hs02_00515361 predicted 297
9 SASI_Hs02_00515362 predicted 854
10 SASI_Hs02_00515363 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496513
POM121L8P MISSION shRNA Bacterial Glycerol Stock
POM121 transmembrane nucleoporin-like 8 pseudogene
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-344s1c1
Sequence:CCGGGCAAGTCGTCTCAGGAAACTTCTCGAGAAGTTTCCTGAGACGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-345s1c1
Sequence:CCGGCAAGTCGTCTCAGGAAACTTTCTCGAGAAAGTTTCCTGAGACGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-204s1c1
Sequence:CCGGGACTCAGCAGCAACACCAAATCTCGAGATTTGGTGTTGCTGCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-329s1c1
Sequence:CCGGGAAGTCAACATGCACGCAAGTCTCGAGACTTGCGTGCATGTTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-319s1c1
Sequence:CCGGCGCTGATCATGAAGTCAACATCTCGAGATGTTGACTTCATGATCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_496513.1-667s1c1
Sequence:CCGGGTAGCTGTAGACCCAAAGCAACTCGAGTTGCTTTGGGTCTACAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496513
POM121L8P MISSION shRNA shRNA Plasmid DNA
POM121 transmembrane nucleoporin-like 8 pseudogene
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-344s1c1
Sequence:CCGGGCAAGTCGTCTCAGGAAACTTCTCGAGAAGTTTCCTGAGACGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-345s1c1
Sequence:CCGGCAAGTCGTCTCAGGAAACTTTCTCGAGAAAGTTTCCTGAGACGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-204s1c1
Sequence:CCGGGACTCAGCAGCAACACCAAATCTCGAGATTTGGTGTTGCTGCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-329s1c1
Sequence:CCGGGAAGTCAACATGCACGCAAGTCTCGAGACTTGCGTGCATGTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-319s1c1
Sequence:CCGGCGCTGATCATGAAGTCAACATCTCGAGATGTTGACTTCATGATCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_496513.1-667s1c1
Sequence:CCGGGTAGCTGTAGACCCAAAGCAACTCGAGTTGCTTTGGGTCTACAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496513
POM121L8P MISSION shRNA Lentiviral Transduction Particles
POM121 transmembrane nucleoporin-like 8 pseudogene
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-344s1c1
Sequence:CCGGGCAAGTCGTCTCAGGAAACTTCTCGAGAAGTTTCCTGAGACGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-345s1c1
Sequence:CCGGCAAGTCGTCTCAGGAAACTTTCTCGAGAAAGTTTCCTGAGACGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-204s1c1
Sequence:CCGGGACTCAGCAGCAACACCAAATCTCGAGATTTGGTGTTGCTGCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-329s1c1
Sequence:CCGGGAAGTCAACATGCACGCAAGTCTCGAGACTTGCGTGCATGTTGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496513.1-319s1c1
Sequence:CCGGCGCTGATCATGAAGTCAACATCTCGAGATGTTGACTTCATGATCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_496513.1-667s1c1
Sequence:CCGGGTAGCTGTAGACCCAAAGCAACTCGAGTTGCTTTGGGTCTACAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)