EMAIL THIS PAGE TO A FRIEND

POMGNT1

protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)

111 Gene Product Result for
Synonyms: GNTI.2 GnT I.2 LGMD2O MDDGA3 MDDGB3 MDDGC3 MEB MGAT1.2 gnT-I.2
Gene ID:
Human(55624) Summary: The protein encoded by this gene is a type II transmembrane protein that resides in the golgi. It participates in O-mannosyl glycosylation, and is specific for alpha linked terminal mannose. Mutations in this gene are associated with muscle-eye-brain (MEB) disease. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2008]
Mouse(68273) protein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Rat(362567) protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Zebrafish(571876) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
dog(482511) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
domestic cat(101094034) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
chicken(429097) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
cow(506551) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
sheep(101102099) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
domestic guinea pig(100733562) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
naked mole-rat(101720446) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
Domestic Rabbit(100344739) protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017739 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017739 Rosetta Predictions human pricing
NM_001007747 Rosetta Predictions rat pricing
NM_026651 Rosetta Predictions mouse pricing
NM_029786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085093 predicted 463
2 SASI_Hs01_00085096 predicted 614
3 SASI_Hs02_00350539 predicted 360
4 SASI_Hs01_00085097 predicted 1046
5 SASI_Hs01_00085098 predicted 1828
6 SASI_Hs01_00085099 predicted 1687
7 SASI_Hs01_00085100 predicted 1296
8 SASI_Hs01_00085101 predicted 2136
9 SASI_Hs02_00350540 predicted 1298
10 SASI_Hs01_00085102 predicted 1677
11 SASI_Hs01_00085094 predicted 1080
12 SASI_Hs01_00085095 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033245 predicted 1737
2 SASI_Rn02_00198941 predicted 1147
3 SASI_Rn01_00033246 predicted 1134
4 SASI_Rn01_00033247 predicted 1692
5 SASI_Rn01_00033248 predicted 601
6 SASI_Rn01_00033249 predicted 1139
7 SASI_Rn01_00033250 predicted 1279
8 SASI_Rn01_00033251 predicted 1758
9 SASI_Rn01_00033252 predicted 1665
10 SASI_Rn01_00033253 predicted 1166
11 SASI_Rn01_00033244 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103786 predicted 2236
2 SASI_Mm01_00103787 predicted 1112
3 SASI_Mm01_00103788 predicted 2225
4 SASI_Mm01_00103789 predicted 1074
5 SASI_Mm01_00103790 predicted 2178
6 SASI_Mm01_00103791 predicted 2282
7 SASI_Mm01_00103792 predicted 1069
8 SASI_Mm01_00103793 predicted 1212
9 SASI_Mm01_00103794 predicted 1150
10 SASI_Mm01_00103795 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025648 predicted 2205
2 SASI_Mm01_00025649 predicted 1079
3 SASI_Mm01_00025650 predicted 2195
4 SASI_Mm01_00025651 predicted 1044
5 SASI_Mm01_00025652 predicted 2150
6 SASI_Mm01_00025653 predicted 2254
7 SASI_Mm01_00025654 predicted 1039
8 SASI_Mm01_00025655 predicted 1178
9 SASI_Mm01_00025656 predicted 1122
10 SASI_Mm01_00025657 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017739
VALIDATED
POMGNT1 MISSION shRNA Bacterial Glycerol Stock
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017739.3-980s21c1
Sequence:CCGGTGAGGGCTATGGAAGTGTATGCTCGAGCATACACTTCCATAGCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017739.3-1085s21c1
Sequence:CCGGTGCAGGGAACCGACCCAATTACTCGAGTAATTGGGTCGGTTCCCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1024s1c1
Sequence:CCGGCCAGACAACAAGGTCCTCAATCTCGAGATTGAGGACCTTGTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1657s1c1
Sequence:CCGGCTCAACATGAATGGCTACTTTCTCGAGAAAGTAGCCATTCATGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-618s1c1
Sequence:CCGGCATGGTGCTATTCCTCAACATCTCGAGATGTTGAGGAATAGCACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017739.1-212s1c1
Sequence:CCGGCCTGGAAGTATAAACTGACAACTCGAGTTGTCAGTTTATACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1971s1c1
Sequence:CCGGCCTGTGGAGATTGTTTCGGAACTCGAGTTCCGAAACAATCTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017739
VALIDATED
POMGNT1 MISSION shRNA shRNA Plasmid DNA
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017739.3-980s21c1
Sequence:CCGGTGAGGGCTATGGAAGTGTATGCTCGAGCATACACTTCCATAGCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017739.3-1085s21c1
Sequence:CCGGTGCAGGGAACCGACCCAATTACTCGAGTAATTGGGTCGGTTCCCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1024s1c1
Sequence:CCGGCCAGACAACAAGGTCCTCAATCTCGAGATTGAGGACCTTGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1657s1c1
Sequence:CCGGCTCAACATGAATGGCTACTTTCTCGAGAAAGTAGCCATTCATGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-618s1c1
Sequence:CCGGCATGGTGCTATTCCTCAACATCTCGAGATGTTGAGGAATAGCACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017739.1-212s1c1
Sequence:CCGGCCTGGAAGTATAAACTGACAACTCGAGTTGTCAGTTTATACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1971s1c1
Sequence:CCGGCCTGTGGAGATTGTTTCGGAACTCGAGTTCCGAAACAATCTCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017739
VALIDATED
POMGNT1 MISSION shRNA Lentiviral Transduction Particles
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017739.3-980s21c1
Sequence:CCGGTGAGGGCTATGGAAGTGTATGCTCGAGCATACACTTCCATAGCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017739.3-1085s21c1
Sequence:CCGGTGCAGGGAACCGACCCAATTACTCGAGTAATTGGGTCGGTTCCCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1024s1c1
Sequence:CCGGCCAGACAACAAGGTCCTCAATCTCGAGATTGAGGACCTTGTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1657s1c1
Sequence:CCGGCTCAACATGAATGGCTACTTTCTCGAGAAAGTAGCCATTCATGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-618s1c1
Sequence:CCGGCATGGTGCTATTCCTCAACATCTCGAGATGTTGAGGAATAGCACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017739.1-212s1c1
Sequence:CCGGCCTGGAAGTATAAACTGACAACTCGAGTTGTCAGTTTATACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017739.1-1971s1c1
Sequence:CCGGCCTGTGGAGATTGTTTCGGAACTCGAGTTCCGAAACAATCTCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029786
VALIDATED
POMGNT1 MISSION shRNA Bacterial Glycerol Stock
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-2334s21c1
Sequence:CCGGGCCTGGCTCAGAACCTATTTACTCGAGTAAATAGGTTCTGAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-223s21c1
Sequence:CCGGTACCTTACCTGGAAGTATAAACTCGAGTTTATACTTCCAGGTAAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-1839s21c1
Sequence:CCGGTGCCAAGTGCCTCCATATTTGCTCGAGCAAATATGGAGGCACTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029786.2-943s21c1
Sequence:CCGGCCAGACAATAAGGTCCTCAATCTCGAGATTGAGGACCTTATTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-1040s21c1
Sequence:CCGGGGGTATCTCCACAGATGATAACTCGAGTTATCATCTGTGGAGATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-587s21c1
Sequence:CCGGTGATGGCAAAGCGCGTGTTTGCTCGAGCAAACACGCGCTTTGCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-2210s1c1
Sequence:CCGGCCTGAGTTTAAGGTCTATTTACTCGAGTAAATAGACCTTAAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029786.1-1768s1c1
Sequence:CCGGCCACACCTATGTGGCGTTTATCTCGAGATAAACGCCACATAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-1180s1c1
Sequence:CCGGCACTGCCACTTTCAACCTGTTCTCGAGAACAGGTTGAAAGTGGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-1882s1c1
Sequence:CCGGCCTGTGGAGATTATTTCGGAACTCGAGTTCCGAAATAATCTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-935s1c1
Sequence:CCGGCCAGACAATAAGGTCCTCAATCTCGAGATTGAGGACCTTATTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029786
VALIDATED
POMGNT1 MISSION shRNA shRNA Plasmid DNA
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-2334s21c1
Sequence:CCGGGCCTGGCTCAGAACCTATTTACTCGAGTAAATAGGTTCTGAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-223s21c1
Sequence:CCGGTACCTTACCTGGAAGTATAAACTCGAGTTTATACTTCCAGGTAAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-1839s21c1
Sequence:CCGGTGCCAAGTGCCTCCATATTTGCTCGAGCAAATATGGAGGCACTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029786.2-943s21c1
Sequence:CCGGCCAGACAATAAGGTCCTCAATCTCGAGATTGAGGACCTTATTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-1040s21c1
Sequence:CCGGGGGTATCTCCACAGATGATAACTCGAGTTATCATCTGTGGAGATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-587s21c1
Sequence:CCGGTGATGGCAAAGCGCGTGTTTGCTCGAGCAAACACGCGCTTTGCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-2210s1c1
Sequence:CCGGCCTGAGTTTAAGGTCTATTTACTCGAGTAAATAGACCTTAAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029786.1-1768s1c1
Sequence:CCGGCCACACCTATGTGGCGTTTATCTCGAGATAAACGCCACATAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-1180s1c1
Sequence:CCGGCACTGCCACTTTCAACCTGTTCTCGAGAACAGGTTGAAAGTGGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-1882s1c1
Sequence:CCGGCCTGTGGAGATTATTTCGGAACTCGAGTTCCGAAATAATCTCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-935s1c1
Sequence:CCGGCCAGACAATAAGGTCCTCAATCTCGAGATTGAGGACCTTATTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029786
VALIDATED
POMGNT1 MISSION shRNA Lentiviral Transduction Particles
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-2334s21c1
Sequence:CCGGGCCTGGCTCAGAACCTATTTACTCGAGTAAATAGGTTCTGAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-223s21c1
Sequence:CCGGTACCTTACCTGGAAGTATAAACTCGAGTTTATACTTCCAGGTAAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-1839s21c1
Sequence:CCGGTGCCAAGTGCCTCCATATTTGCTCGAGCAAATATGGAGGCACTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029786.2-943s21c1
Sequence:CCGGCCAGACAATAAGGTCCTCAATCTCGAGATTGAGGACCTTATTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-1040s21c1
Sequence:CCGGGGGTATCTCCACAGATGATAACTCGAGTTATCATCTGTGGAGATACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029786.2-587s21c1
Sequence:CCGGTGATGGCAAAGCGCGTGTTTGCTCGAGCAAACACGCGCTTTGCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-2210s1c1
Sequence:CCGGCCTGAGTTTAAGGTCTATTTACTCGAGTAAATAGACCTTAAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029786.1-1768s1c1
Sequence:CCGGCCACACCTATGTGGCGTTTATCTCGAGATAAACGCCACATAGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-1180s1c1
Sequence:CCGGCACTGCCACTTTCAACCTGTTCTCGAGAACAGGTTGAAAGTGGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-1882s1c1
Sequence:CCGGCCTGTGGAGATTATTTCGGAACTCGAGTTCCGAAATAATCTCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029786.1-935s1c1
Sequence:CCGGCCAGACAATAAGGTCCTCAATCTCGAGATTGAGGACCTTATTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)