EMAIL THIS PAGE TO A FRIEND

POMGNT2

protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)

40 Gene Product Result for
Synonyms: AGO61 C3orf39 GTDC2 MDDGA8
Gene ID:
Human(84892) Summary: This gene encodes a protein with glycosyltransferase activity although its function is not currently known. [provided by RefSeq, Sep 2012]
Mouse(215494) protein O-linked mannose beta 1,4-N-acetylglucosaminyltransferase 2
Zebrafish(497644) protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032806 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154921 MISSION® esiRNA esiRNA human C3orf39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032806 Rosetta Predictions human pricing
NM_153540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195896 predicted 2156
2 SASI_Hs01_00195897 predicted 1437
3 SASI_Hs01_00195898 predicted 574
4 SASI_Hs01_00195899 predicted 1441
5 SASI_Hs01_00195900 predicted 1864
6 SASI_Hs01_00195901 predicted 1927
7 SASI_Hs01_00195902 predicted 718
8 SASI_Hs01_00195905 predicted 1505
9 SASI_Hs02_00360370 predicted 1466
10 SASI_Hs02_00360371 predicted 1225
11 SASI_Hs01_00195903 predicted 2160
12 SASI_Hs01_00195904 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154417 predicted 864
2 SASI_Mm01_00154418 predicted 1763
3 SASI_Mm01_00154419 predicted 482
4 SASI_Mm01_00154420 predicted 460
5 SASI_Mm01_00154421 predicted 930
6 SASI_Mm01_00154422 predicted 1154
7 SASI_Mm01_00154423 predicted 1378
8 SASI_Mm01_00154424 predicted 817
9 SASI_Mm01_00154425 predicted 1824
10 SASI_Mm02_00343306 predicted 655
11 SASI_Mm01_00154426 predicted 1858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153540
POMGNT2 MISSION shRNA Bacterial Glycerol Stock
protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153540.2-1899s1c1
Sequence:CCGGGAACACGTATGTGCCTTACATCTCGAGATGTAAGGCACATACGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153540.2-1932s1c1
Sequence:CCGGGAACCACACCTTCACAGAGAACTCGAGTTCTCTGTGAAGGTGTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-708s21c1
Sequence:CCGGATAACCTCATGCACGTCTTTCCTCGAGGAAAGACGTGCATGAGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153540.3-2036s1c1
Sequence:CCGGCTAGCAGCTGTGGTGATAAATCTCGAGATTTATCACCACAGCTGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153540.3-2036s21c1
Sequence:CCGGCTAGCAGCTGTGGTGATAAATCTCGAGATTTATCACCACAGCTGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-824s21c1
Sequence:CCGGGCCCACTTTGACCTCTATAAACTCGAGTTTATAGAGGTCAAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-1024s21c1
Sequence:CCGGCACGCGCTTCATGACTGAAAGCTCGAGCTTTCAGTCATGAAGCGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-1894s21c1
Sequence:CCGGGGTGTGGGTCCGCTGTATATTCTCGAGAATATACAGCGGACCCACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153540
POMGNT2 MISSION shRNA shRNA Plasmid DNA
protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153540.2-1899s1c1
Sequence:CCGGGAACACGTATGTGCCTTACATCTCGAGATGTAAGGCACATACGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153540.2-1932s1c1
Sequence:CCGGGAACCACACCTTCACAGAGAACTCGAGTTCTCTGTGAAGGTGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-708s21c1
Sequence:CCGGATAACCTCATGCACGTCTTTCCTCGAGGAAAGACGTGCATGAGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153540.3-2036s1c1
Sequence:CCGGCTAGCAGCTGTGGTGATAAATCTCGAGATTTATCACCACAGCTGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153540.3-2036s21c1
Sequence:CCGGCTAGCAGCTGTGGTGATAAATCTCGAGATTTATCACCACAGCTGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-824s21c1
Sequence:CCGGGCCCACTTTGACCTCTATAAACTCGAGTTTATAGAGGTCAAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-1024s21c1
Sequence:CCGGCACGCGCTTCATGACTGAAAGCTCGAGCTTTCAGTCATGAAGCGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-1894s21c1
Sequence:CCGGGGTGTGGGTCCGCTGTATATTCTCGAGAATATACAGCGGACCCACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153540
POMGNT2 MISSION shRNA Lentiviral Transduction Particles
protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153540.2-1899s1c1
Sequence:CCGGGAACACGTATGTGCCTTACATCTCGAGATGTAAGGCACATACGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153540.2-1932s1c1
Sequence:CCGGGAACCACACCTTCACAGAGAACTCGAGTTCTCTGTGAAGGTGTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-708s21c1
Sequence:CCGGATAACCTCATGCACGTCTTTCCTCGAGGAAAGACGTGCATGAGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153540.3-2036s1c1
Sequence:CCGGCTAGCAGCTGTGGTGATAAATCTCGAGATTTATCACCACAGCTGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153540.3-2036s21c1
Sequence:CCGGCTAGCAGCTGTGGTGATAAATCTCGAGATTTATCACCACAGCTGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-824s21c1
Sequence:CCGGGCCCACTTTGACCTCTATAAACTCGAGTTTATAGAGGTCAAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-1024s21c1
Sequence:CCGGCACGCGCTTCATGACTGAAAGCTCGAGCTTTCAGTCATGAAGCGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153540.3-1894s21c1
Sequence:CCGGGGTGTGGGTCCGCTGTATATTCTCGAGAATATACAGCGGACCCACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032806
POMGNT2 MISSION shRNA Bacterial Glycerol Stock
protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1861s1c1
Sequence:CCGGGCAGATCCCATGGAACCTTAACTCGAGTTAAGGTTCCATGGGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1972s1c1
Sequence:CCGGCCACACCTTCACTGAGAACATCTCGAGATGTTCTCAGTGAAGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1223s1c1
Sequence:CCGGCGAACCCAGAACAGACTCATTCTCGAGAATGAGTCTGTTCTGGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1969s1c1
Sequence:CCGGGAACCACACCTTCACTGAGAACTCGAGTTCTCAGTGAAGGTGTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1864s1c1
Sequence:CCGGGATCCCATGGAACCTTAAATACTCGAGTATTTAAGGTTCCATGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1228s1c1
Sequence:CCGGCCAGAACAGACTCATTCTGAACTCGAGTTCAGAATGAGTCTGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032806.4-2349s1c1
Sequence:CCGGGCAAAGAATCACAAGGAACCTCTCGAGAGGTTCCTTGTGATTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1936s1c1
Sequence:CCGGGAACACCTACGTGCCTTACATCTCGAGATGTAAGGCACGTAGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032806.4-828s21c1
Sequence:CCGGACAACCTCATGCACGTCTTTCCTCGAGGAAAGACGTGCATGAGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032806.4-2132s21c1
Sequence:CCGGAGCGTCCCTGGGCCCATTAATCTCGAGATTAATGGGCCCAGGGACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032806.4-2161s21c1
Sequence:CCGGGGAGACTTCTGGGAACTATTTCTCGAGAAATAGTTCCCAGAAGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032806
POMGNT2 MISSION shRNA shRNA Plasmid DNA
protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1861s1c1
Sequence:CCGGGCAGATCCCATGGAACCTTAACTCGAGTTAAGGTTCCATGGGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1972s1c1
Sequence:CCGGCCACACCTTCACTGAGAACATCTCGAGATGTTCTCAGTGAAGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1223s1c1
Sequence:CCGGCGAACCCAGAACAGACTCATTCTCGAGAATGAGTCTGTTCTGGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1969s1c1
Sequence:CCGGGAACCACACCTTCACTGAGAACTCGAGTTCTCAGTGAAGGTGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1864s1c1
Sequence:CCGGGATCCCATGGAACCTTAAATACTCGAGTATTTAAGGTTCCATGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1228s1c1
Sequence:CCGGCCAGAACAGACTCATTCTGAACTCGAGTTCAGAATGAGTCTGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032806.4-2349s1c1
Sequence:CCGGGCAAAGAATCACAAGGAACCTCTCGAGAGGTTCCTTGTGATTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1936s1c1
Sequence:CCGGGAACACCTACGTGCCTTACATCTCGAGATGTAAGGCACGTAGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032806.4-828s21c1
Sequence:CCGGACAACCTCATGCACGTCTTTCCTCGAGGAAAGACGTGCATGAGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032806.4-2132s21c1
Sequence:CCGGAGCGTCCCTGGGCCCATTAATCTCGAGATTAATGGGCCCAGGGACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032806.4-2161s21c1
Sequence:CCGGGGAGACTTCTGGGAACTATTTCTCGAGAAATAGTTCCCAGAAGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032806
POMGNT2 MISSION shRNA Lentiviral Transduction Particles
protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1861s1c1
Sequence:CCGGGCAGATCCCATGGAACCTTAACTCGAGTTAAGGTTCCATGGGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1972s1c1
Sequence:CCGGCCACACCTTCACTGAGAACATCTCGAGATGTTCTCAGTGAAGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1223s1c1
Sequence:CCGGCGAACCCAGAACAGACTCATTCTCGAGAATGAGTCTGTTCTGGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1969s1c1
Sequence:CCGGGAACCACACCTTCACTGAGAACTCGAGTTCTCAGTGAAGGTGTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1864s1c1
Sequence:CCGGGATCCCATGGAACCTTAAATACTCGAGTATTTAAGGTTCCATGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032806.4-1228s1c1
Sequence:CCGGCCAGAACAGACTCATTCTGAACTCGAGTTCAGAATGAGTCTGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032806.4-2349s1c1
Sequence:CCGGGCAAAGAATCACAAGGAACCTCTCGAGAGGTTCCTTGTGATTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032806.4-1936s1c1
Sequence:CCGGGAACACCTACGTGCCTTACATCTCGAGATGTAAGGCACGTAGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032806.4-828s21c1
Sequence:CCGGACAACCTCATGCACGTCTTTCCTCGAGGAAAGACGTGCATGAGGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032806.4-2132s21c1
Sequence:CCGGAGCGTCCCTGGGCCCATTAATCTCGAGATTAATGGGCCCAGGGACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032806.4-2161s21c1
Sequence:CCGGGGAGACTTCTGGGAACTATTTCTCGAGAAATAGTTCCCAGAAGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)