EMAIL THIS PAGE TO A FRIEND

POMP

proteasome maturation protein

59 Gene Product Result for
Synonyms: C13orf12 PNAS-110 UMP1
UniProtKB ID: Q9Y244, A5HKJ2, D6MXU3, Q9HB69
Gene ID:
Human(51371) Summary: The protein encoded by this gene is a molecular chaperone that binds 20S preproteasome components and is essential for 20S proteasome formation. The 20S proteasome is the proteolytically active component of the 26S proteasome complex. The encoded protein is degraded before the maturation of the 20S proteasome is complete. A variant in the 5' UTR of this gene has been associated with KLICK syndrome, a rare skin disorder.[provided by RefSeq, Aug 2010]
Mouse(66537) proteasome maturation protein
Rat(288455) proteasome maturation protein
fruit fly(35342) CG9324 gene product from transcript CG9324-RA
Zebrafish(445030) proteasome maturation protein
domestic cat(101099518) proteasome maturation protein
dog(477325) proteasome maturation protein
chicken(418925) proteasome maturation protein
cow(510314) proteasome maturation protein
sheep(101113603) proteasome maturation protein
naked mole-rat(101698885) proteasome maturation protein
domestic guinea pig(100721012) proteasome maturation protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015932 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015932 Rosetta Predictions human pricing
NM_001100942 Rosetta Predictions rat pricing
NM_025624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010430 predicted 282
2 SASI_Hs02_00348557 predicted 346
3 SASI_Hs01_00010431 predicted 588
4 SASI_Hs01_00010432 predicted 393
5 SASI_Hs01_00010433 predicted 489
6 SASI_Hs01_00010435 predicted 605
7 SASI_Hs01_00010436 predicted 477
8 SASI_Hs01_00010437 predicted 352
9 SASI_Hs01_00010438 predicted 603
10 SASI_Hs01_00010439 predicted 355
11 SASI_Hs01_00010434 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210732 predicted 368
2 SASI_Rn02_00210733 predicted 287
3 SASI_Rn02_00210734 predicted 47
4 SASI_Rn02_00210735 predicted 290
5 SASI_Rn02_00210736 predicted 144
6 SASI_Rn02_00210737 predicted 148
7 SASI_Rn02_00210738 predicted 185
8 SASI_Rn02_00210739 predicted 48
9 SASI_Rn02_00210740 predicted 281
10 SASI_Rn02_00210741 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167991 predicted 412
2 SASI_Mm01_00167993 predicted 318
3 SASI_Mm01_00167994 predicted 449
4 SASI_Mm01_00167995 predicted 502
5 SASI_Mm01_00167996 predicted 506
6 SASI_Mm01_00167997 predicted 488
7 SASI_Mm01_00167999 predicted 335
8 SASI_Mm02_00328679 predicted 226
9 SASI_Mm02_00328680 predicted 504
10 SASI_Mm02_00328681 predicted 338
11 SASI_Mm01_00167992 predicted 351
12 SASI_Mm01_00167998 predicted 352
13 SASI_Mm01_00168000 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025624
VALIDATED
POMP MISSION shRNA Bacterial Glycerol Stock
proteasome maturation protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-455s21c1
Sequence:CCGGGTGATGGTGGAACATAAGCTGCTCGAGCAGCTTATGTTCCACCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-456s1c1
Sequence:CCGGGTGATGGTGGAACATAAGCTGCTCGAGCAGCTTATGTTCCACCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-289s1c1
Sequence:CCGGCCCTGAAGTTACAGATGGAATCTCGAGATTCCATCTGTAACTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025624.1-549s1c1
Sequence:CCGGGATGTTCACAGCAGTAAAGTACTCGAGTACTTTACTGCTGTGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-233s1c1
Sequence:CCGGCAACCAGGACAAGATGAACTTCTCGAGAAGTTCATCTTGTCCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-89s1c1
Sequence:CCGGGCTGAAGGACAGTATTCCAGTCTCGAGACTGGAATACTGTCCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025624.1-559s1c1
Sequence:CCGGGCAGTAAAGTACAGAGAGGATCTCGAGATCCTCTCTGTACTTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-88s21c1
Sequence:CCGGGCTGAAGGACAGTATTCCAGTCTCGAGACTGGAATACTGTCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025624.1-352s1c1
Sequence:CCGGGCTCAAACCTCTCACTGGATACTCGAGTATCCAGTGAGAGGTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025624.1-355s1c1
Sequence:CCGGCAAACCTCTCACTGGATATTTCTCGAGAAATATCCAGTGAGAGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025624.2-548s21c1
Sequence:CCGGGATGTTCACAGCAGTAAAGTACTCGAGTACTTTACTGCTGTGAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-232s21c1
Sequence:CCGGCAACCAGGACAAGATGAACTTCTCGAGAAGTTCATCTTGTCCTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025624
VALIDATED
POMP MISSION shRNA shRNA Plasmid DNA
proteasome maturation protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-455s21c1
Sequence:CCGGGTGATGGTGGAACATAAGCTGCTCGAGCAGCTTATGTTCCACCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-456s1c1
Sequence:CCGGGTGATGGTGGAACATAAGCTGCTCGAGCAGCTTATGTTCCACCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-289s1c1
Sequence:CCGGCCCTGAAGTTACAGATGGAATCTCGAGATTCCATCTGTAACTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025624.1-549s1c1
Sequence:CCGGGATGTTCACAGCAGTAAAGTACTCGAGTACTTTACTGCTGTGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-233s1c1
Sequence:CCGGCAACCAGGACAAGATGAACTTCTCGAGAAGTTCATCTTGTCCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-89s1c1
Sequence:CCGGGCTGAAGGACAGTATTCCAGTCTCGAGACTGGAATACTGTCCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025624.1-559s1c1
Sequence:CCGGGCAGTAAAGTACAGAGAGGATCTCGAGATCCTCTCTGTACTTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-88s21c1
Sequence:CCGGGCTGAAGGACAGTATTCCAGTCTCGAGACTGGAATACTGTCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025624.1-352s1c1
Sequence:CCGGGCTCAAACCTCTCACTGGATACTCGAGTATCCAGTGAGAGGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025624.1-355s1c1
Sequence:CCGGCAAACCTCTCACTGGATATTTCTCGAGAAATATCCAGTGAGAGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025624.2-548s21c1
Sequence:CCGGGATGTTCACAGCAGTAAAGTACTCGAGTACTTTACTGCTGTGAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-232s21c1
Sequence:CCGGCAACCAGGACAAGATGAACTTCTCGAGAAGTTCATCTTGTCCTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025624
VALIDATED
POMP MISSION shRNA Lentiviral Transduction Particles
proteasome maturation protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-455s21c1
Sequence:CCGGGTGATGGTGGAACATAAGCTGCTCGAGCAGCTTATGTTCCACCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-456s1c1
Sequence:CCGGGTGATGGTGGAACATAAGCTGCTCGAGCAGCTTATGTTCCACCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-289s1c1
Sequence:CCGGCCCTGAAGTTACAGATGGAATCTCGAGATTCCATCTGTAACTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025624.1-549s1c1
Sequence:CCGGGATGTTCACAGCAGTAAAGTACTCGAGTACTTTACTGCTGTGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-233s1c1
Sequence:CCGGCAACCAGGACAAGATGAACTTCTCGAGAAGTTCATCTTGTCCTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025624.1-89s1c1
Sequence:CCGGGCTGAAGGACAGTATTCCAGTCTCGAGACTGGAATACTGTCCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025624.1-559s1c1
Sequence:CCGGGCAGTAAAGTACAGAGAGGATCTCGAGATCCTCTCTGTACTTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-88s21c1
Sequence:CCGGGCTGAAGGACAGTATTCCAGTCTCGAGACTGGAATACTGTCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025624.1-352s1c1
Sequence:CCGGGCTCAAACCTCTCACTGGATACTCGAGTATCCAGTGAGAGGTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025624.1-355s1c1
Sequence:CCGGCAAACCTCTCACTGGATATTTCTCGAGAAATATCCAGTGAGAGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025624.2-548s21c1
Sequence:CCGGGATGTTCACAGCAGTAAAGTACTCGAGTACTTTACTGCTGTGAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025624.2-232s21c1
Sequence:CCGGCAACCAGGACAAGATGAACTTCTCGAGAAGTTCATCTTGTCCTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015932
VALIDATED
POMP MISSION shRNA Bacterial Glycerol Stock
proteasome maturation protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015932.4-413s21c1
Sequence:CCGGCTATTGGATTTGAGGATATTCCTCGAGGAATATCCTCAAATCCAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015932.4-244s21c1
Sequence:CCGGTTCCAGCTCAACCAAGATAAACTCGAGTTTATCTTGGTTGAGCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015932.4-294s21c1
Sequence:CCGGGGGTCTATTTGCTCCGCTAAACTCGAGTTTAGCGGAGCAAATAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015932.4-470s21c1
Sequence:CCGGCACACTTGATGGTGGAATATACTCGAGTATATTCCACCATCAAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015932.2-687s1c1
Sequence:CCGGGAGATCATGTTAAAGCTCTTACTCGAGTAAGAGCTTTAACATGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015932.4-618s21c1
Sequence:CCGGAGTAGTATCAGTGATCATTTACTCGAGTAAATGATCACTGATACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015932
VALIDATED
POMP MISSION shRNA shRNA Plasmid DNA
proteasome maturation protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015932.4-413s21c1
Sequence:CCGGCTATTGGATTTGAGGATATTCCTCGAGGAATATCCTCAAATCCAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015932.4-244s21c1
Sequence:CCGGTTCCAGCTCAACCAAGATAAACTCGAGTTTATCTTGGTTGAGCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015932.4-294s21c1
Sequence:CCGGGGGTCTATTTGCTCCGCTAAACTCGAGTTTAGCGGAGCAAATAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015932.4-470s21c1
Sequence:CCGGCACACTTGATGGTGGAATATACTCGAGTATATTCCACCATCAAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015932.2-687s1c1
Sequence:CCGGGAGATCATGTTAAAGCTCTTACTCGAGTAAGAGCTTTAACATGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015932.4-618s21c1
Sequence:CCGGAGTAGTATCAGTGATCATTTACTCGAGTAAATGATCACTGATACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015932
VALIDATED
POMP MISSION shRNA Lentiviral Transduction Particles
proteasome maturation protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015932.4-413s21c1
Sequence:CCGGCTATTGGATTTGAGGATATTCCTCGAGGAATATCCTCAAATCCAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015932.4-244s21c1
Sequence:CCGGTTCCAGCTCAACCAAGATAAACTCGAGTTTATCTTGGTTGAGCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015932.4-294s21c1
Sequence:CCGGGGGTCTATTTGCTCCGCTAAACTCGAGTTTAGCGGAGCAAATAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015932.4-470s21c1
Sequence:CCGGCACACTTGATGGTGGAATATACTCGAGTATATTCCACCATCAAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015932.2-687s1c1
Sequence:CCGGGAGATCATGTTAAAGCTCTTACTCGAGTAAGAGCTTTAACATGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015932.4-618s21c1
Sequence:CCGGAGTAGTATCAGTGATCATTTACTCGAGTAAATGATCACTGATACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)