EMAIL THIS PAGE TO A FRIEND

POMT1

protein-O-mannosyltransferase 1

71 Gene Product Result for
Synonyms: LGMD2K MDDGA1 MDDGB1 MDDGC1 RT
Gene ID:
Human(10585) Summary: The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Mouse(99011) protein-O-mannosyltransferase 1
Rat(84430) protein-O-mannosyltransferase 1
domestic guinea pig(100728528) protein-O-mannosyltransferase 1
naked mole-rat(101719016) protein-O-mannosyltransferase 1
cow(617609) protein-O-mannosyltransferase 1
sheep(101121672) protein-O-mannosyltransferase 1
Zebrafish(569769) protein-O-mannosyltransferase 1
chicken(417175) protein-O-mannosyltransferase 1
domestic cat(101088629) protein-O-mannosyltransferase 1
Horse(100069575) protein-O-mannosyltransferase 1
dog(608039) protein-O-mannosyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007171 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083721 MISSION® esiRNA esiRNA human POMT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077365 Rosetta Predictions human pricing
NM_001077366 Rosetta Predictions human pricing
NM_007171 Rosetta Predictions human pricing
NM_053406 Rosetta Predictions rat pricing
NM_145145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312414 predicted 605
2 SASI_Hs02_00312415 predicted 2417
3 SASI_Hs02_00312416 predicted 1537
4 SASI_Hs02_00312417 predicted 639
5 SASI_Hs02_00312418 predicted 606
6 SASI_Hs02_00312419 predicted 1416
7 SASI_Hs02_00312420 predicted 2077
8 SASI_Hs02_00312421 predicted 1914
9 SASI_Hs02_00312422 predicted 626
10 SASI_Hs02_00312423 predicted 2421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312424 predicted 453
2 SASI_Hs02_00312425 predicted 2263
3 SASI_Hs02_00312426 predicted 1393
4 SASI_Hs02_00312427 predicted 489
5 SASI_Hs02_00312428 predicted 461
6 SASI_Hs02_00312429 predicted 1271
7 SASI_Hs02_00312430 predicted 1923
8 SASI_Hs02_00312431 predicted 1761
9 SASI_Hs02_00312432 predicted 473
10 SASI_Hs02_00312433 predicted 2262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343107 predicted 605
2 SASI_Hs01_00172563 predicted 2481
3 SASI_Hs01_00172562 predicted 1611
4 SASI_Hs01_00172564 predicted 639
5 SASI_Hs02_00343108 predicted 606
6 SASI_Hs01_00172565 predicted 1486
7 SASI_Hs01_00172566 predicted 2139
8 SASI_Hs01_00172567 predicted 1981
9 SASI_Hs02_00343109 predicted 624
10 SASI_Hs02_00343110 predicted 2485
11 SASI_Hs01_00172561 predicted 408
12 SASI_Hs01_00172568 predicted 602
13 SASI_Hs01_00172569 predicted 785
14 SASI_Hs01_00172570 predicted 2262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039613 predicted 1415
2 SASI_Rn01_00039614 predicted 729
3 SASI_Rn01_00039615 predicted 1733
4 SASI_Rn02_00265917 predicted 2029
5 SASI_Rn01_00039617 predicted 1912
6 SASI_Rn01_00039618 predicted 1760
7 SASI_Rn01_00039620 predicted 1065
8 SASI_Rn02_00265918 predicted 935
9 SASI_Rn01_00039621 predicted 906
10 SASI_Rn01_00039616 predicted 2200
11 SASI_Rn01_00039619 predicted 1155
12 SASI_Rn01_00039622 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137114 predicted 582
2 SASI_Mm01_00137115 predicted 839
3 SASI_Mm01_00137116 predicted 2297
4 SASI_Mm01_00137117 predicted 1666
5 SASI_Mm02_00340544 predicted 1959
6 SASI_Mm01_00137118 predicted 2238
7 SASI_Mm01_00137119 predicted 1005
8 SASI_Mm01_00137120 predicted 845
9 SASI_Mm01_00137121 predicted 2269
10 SASI_Mm01_00137122 predicted 982
11 SASI_Mm01_00137123 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007171
POMT1 MISSION shRNA Bacterial Glycerol Stock
protein-O-mannosyltransferase 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007171.3-1820s21c1
Sequence:CCGGCTCAGCTTCATGGCGAGATTCCTCGAGGAATCTCGCCATGAAGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007171.3-2499s21c1
Sequence:CCGGGTCTTGGTCAATGTACGTAATCTCGAGATTACGTACATTGACCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-308s1c1
Sequence:CCGGCGAAGTATATTATGGGCAGTACTCGAGTACTGCCCATAATATACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-2144s1c1
Sequence:CCGGCCTGATGGAGAAGACACTCTTCTCGAGAAGAGTGTCTTCTCCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-2396s1c1
Sequence:CCGGCTGGGACATCTTGATCCGAAACTCGAGTTTCGGATCAAGATGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-1064s1c1
Sequence:CCGGCCAAATCATGTCCAGTGCCTTCTCGAGAAGGCACTGGACATGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007171
POMT1 MISSION shRNA shRNA Plasmid DNA
protein-O-mannosyltransferase 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007171.3-1820s21c1
Sequence:CCGGCTCAGCTTCATGGCGAGATTCCTCGAGGAATCTCGCCATGAAGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007171.3-2499s21c1
Sequence:CCGGGTCTTGGTCAATGTACGTAATCTCGAGATTACGTACATTGACCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-308s1c1
Sequence:CCGGCGAAGTATATTATGGGCAGTACTCGAGTACTGCCCATAATATACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-2144s1c1
Sequence:CCGGCCTGATGGAGAAGACACTCTTCTCGAGAAGAGTGTCTTCTCCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-2396s1c1
Sequence:CCGGCTGGGACATCTTGATCCGAAACTCGAGTTTCGGATCAAGATGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-1064s1c1
Sequence:CCGGCCAAATCATGTCCAGTGCCTTCTCGAGAAGGCACTGGACATGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007171
POMT1 MISSION shRNA Lentiviral Transduction Particles
protein-O-mannosyltransferase 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007171.3-1820s21c1
Sequence:CCGGCTCAGCTTCATGGCGAGATTCCTCGAGGAATCTCGCCATGAAGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007171.3-2499s21c1
Sequence:CCGGGTCTTGGTCAATGTACGTAATCTCGAGATTACGTACATTGACCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-308s1c1
Sequence:CCGGCGAAGTATATTATGGGCAGTACTCGAGTACTGCCCATAATATACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-2144s1c1
Sequence:CCGGCCTGATGGAGAAGACACTCTTCTCGAGAAGAGTGTCTTCTCCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-2396s1c1
Sequence:CCGGCTGGGACATCTTGATCCGAAACTCGAGTTTCGGATCAAGATGTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007171.2-1064s1c1
Sequence:CCGGCCAAATCATGTCCAGTGCCTTCTCGAGAAGGCACTGGACATGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145145
VALIDATED
POMT1 MISSION shRNA Bacterial Glycerol Stock
protein-O-mannosyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-1306s21c1
Sequence:CCGGTCTCCTGCTACATTGACTATACTCGAGTATAGTCAATGTAGCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145145.1-2369s21c1
Sequence:CCGGAGGAACTCCAGGGACTAATTCCTCGAGGAATTAGTCCCTGGAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145145.1-374s21c1
Sequence:CCGGCAGTAGCAATGTGCCTATATGCTCGAGCATATAGGCACATTGCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-2122s21c2
Sequence:CCGGCCCTGGTTGTAGCATGGTATTCTCGAGAATACCATGCTACAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-682s21c2
Sequence:CCGGCCTGTGCAGTTGGGATCAAATCTCGAGATTTGATCCCAACTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145145.1-129s1c1
Sequence:CCGGGACATCAATTTGAACTTGGTACTCGAGTACCAAGTTCAAATTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145145.1-2239s1c1
Sequence:CCGGGCTGGGATATTCTGATCCGAACTCGAGTTCGGATCAGAATATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145145.1-2422s1c1
Sequence:CCGGCCTTGTTTGAAGCAATTGATTCTCGAGAATCAATTGCTTCAAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145145.1-682s1c1
Sequence:CCGGCCTGTGCAGTTGGGATCAAATCTCGAGATTTGATCCCAACTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145145.1-2122s1c1
Sequence:CCGGCCCTGGTTGTAGCATGGTATTCTCGAGAATACCATGCTACAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145145
VALIDATED
POMT1 MISSION shRNA shRNA Plasmid DNA
protein-O-mannosyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-1306s21c1
Sequence:CCGGTCTCCTGCTACATTGACTATACTCGAGTATAGTCAATGTAGCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145145.1-2369s21c1
Sequence:CCGGAGGAACTCCAGGGACTAATTCCTCGAGGAATTAGTCCCTGGAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145145.1-374s21c1
Sequence:CCGGCAGTAGCAATGTGCCTATATGCTCGAGCATATAGGCACATTGCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-2122s21c2
Sequence:CCGGCCCTGGTTGTAGCATGGTATTCTCGAGAATACCATGCTACAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-682s21c2
Sequence:CCGGCCTGTGCAGTTGGGATCAAATCTCGAGATTTGATCCCAACTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145145.1-129s1c1
Sequence:CCGGGACATCAATTTGAACTTGGTACTCGAGTACCAAGTTCAAATTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145145.1-2239s1c1
Sequence:CCGGGCTGGGATATTCTGATCCGAACTCGAGTTCGGATCAGAATATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145145.1-2422s1c1
Sequence:CCGGCCTTGTTTGAAGCAATTGATTCTCGAGAATCAATTGCTTCAAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145145.1-682s1c1
Sequence:CCGGCCTGTGCAGTTGGGATCAAATCTCGAGATTTGATCCCAACTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145145.1-2122s1c1
Sequence:CCGGCCCTGGTTGTAGCATGGTATTCTCGAGAATACCATGCTACAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145145
VALIDATED
POMT1 MISSION shRNA Lentiviral Transduction Particles
protein-O-mannosyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-1306s21c1
Sequence:CCGGTCTCCTGCTACATTGACTATACTCGAGTATAGTCAATGTAGCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145145.1-2369s21c1
Sequence:CCGGAGGAACTCCAGGGACTAATTCCTCGAGGAATTAGTCCCTGGAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145145.1-374s21c1
Sequence:CCGGCAGTAGCAATGTGCCTATATGCTCGAGCATATAGGCACATTGCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-2122s21c2
Sequence:CCGGCCCTGGTTGTAGCATGGTATTCTCGAGAATACCATGCTACAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145145.1-682s21c2
Sequence:CCGGCCTGTGCAGTTGGGATCAAATCTCGAGATTTGATCCCAACTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145145.1-129s1c1
Sequence:CCGGGACATCAATTTGAACTTGGTACTCGAGTACCAAGTTCAAATTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145145.1-2239s1c1
Sequence:CCGGGCTGGGATATTCTGATCCGAACTCGAGTTCGGATCAGAATATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145145.1-2422s1c1
Sequence:CCGGCCTTGTTTGAAGCAATTGATTCTCGAGAATCAATTGCTTCAAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145145.1-682s1c1
Sequence:CCGGCCTGTGCAGTTGGGATCAAATCTCGAGATTTGATCCCAACTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145145.1-2122s1c1
Sequence:CCGGCCCTGGTTGTAGCATGGTATTCTCGAGAATACCATGCTACAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)