EMAIL THIS PAGE TO A FRIEND

POMT2

protein-O-mannosyltransferase 2

108 Gene Product Result for
Synonyms: LGMD2N MDDGA2 MDDGB2 MDDGC2
UniProtKB ID: Q9UKY4, Q9NSG6, Q9P1W0, Q9P1W2
Gene ID:
Human(29954) Summary: The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT1 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS).[provided by RefSeq, Oct 2008]
Mouse(217734) protein-O-mannosyltransferase 2
Rat(688673) protein-O-mannosyltransferase 2
Zebrafish(563878) protein-O-mannosyltransferase 2
dog(480400) protein-O-mannosyltransferase 2
Horse(100059121) protein-O-mannosyltransferase 2
domestic cat(101101141) protein-O-mannosyltransferase 2
chicken(423373) protein-O-mannosyltransferase 2
cow(537054) protein-O-mannosyltransferase 2
sheep(101110065) protein-O-mannosyltransferase 2
naked mole-rat(101706534) protein-O-mannosyltransferase 2
domestic guinea pig(100717943) protein-O-mannosyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037671 MISSION® esiRNA esiRNA human POMT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013382 Rosetta Predictions human pricing
NM_001047114 Rosetta Predictions rat pricing
XM_001067842 Rosetta Predictions rat pricing
NM_153415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243779 predicted 1089
2 SASI_Hs01_00243780 predicted 1854
3 SASI_Hs01_00243781 predicted 2028
4 SASI_Hs01_00243782 predicted 1862
5 SASI_Hs01_00243783 predicted 1872
6 SASI_Hs01_00243784 predicted 1315
7 SASI_Hs01_00243785 predicted 1452
8 SASI_Hs01_00243786 predicted 477
9 SASI_Hs01_00243787 predicted 1598
10 SASI_Hs01_00243788 predicted 1944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206055 predicted 1897
2 SASI_Rn02_00206056 predicted 1976
3 SASI_Rn02_00206057 predicted 1429
4 SASI_Rn02_00206058 predicted 1202
5 SASI_Rn02_00206059 predicted 2154
6 SASI_Rn02_00206060 predicted 2028
7 SASI_Rn02_00206061 predicted 1629
8 SASI_Rn02_00206062 predicted 1825
9 SASI_Rn02_00206063 predicted 1605
10 SASI_Rn02_00206064 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322523 predicted 463
2 SASI_Rn02_00322524 predicted 603
3 SASI_Rn02_00322525 predicted 452
4 SASI_Rn02_00322526 predicted 433
5 SASI_Rn02_00322527 predicted 479
6 SASI_Rn02_00322528 predicted 535
7 SASI_Rn02_00322529 predicted 575
8 SASI_Rn02_00322530 predicted 1180
9 SASI_Rn02_00322531 predicted 1174
10 SASI_Rn02_00322532 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072593 predicted 2051
2 SASI_Mm02_00343204 predicted 720
3 SASI_Mm01_00072594 predicted 2031
4 SASI_Mm01_00072596 predicted 1205
5 SASI_Mm01_00072597 predicted 810
6 SASI_Mm01_00072598 predicted 1694
7 SASI_Mm01_00072599 predicted 887
8 SASI_Mm01_00072600 predicted 1978
9 SASI_Mm01_00072601 predicted 2160
10 SASI_Mm01_00072602 predicted 2020
11 SASI_Mm01_00072595 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013382
VALIDATED
POMT2 MISSION shRNA Bacterial Glycerol Stock
protein-O-mannosyltransferase 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013382.3-1904s1c1
Sequence:CCGGCCTATCAACTATCAGGGCCTACTCGAGTAGGCCCTGATAGTTGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-1067s1c1
Sequence:CCGGGCTCTCTATACAGCCACCTTTCTCGAGAAAGGTGGCTGTATAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-1454s1c1
Sequence:CCGGCGGAACTTGCACAGTCACTATCTCGAGATAGTGACTGTGCAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-2135s1c1
Sequence:CCGGACACTCCATTACTTCCCGTTTCTCGAGAAACGGGAAGTAATGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013382.3-471s1c1
Sequence:CCGGGAAGTTACTATATCAACCGTACTCGAGTACGGTTGATATAGTAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1561s21c1
Sequence:CCGGTGGCGGATTGAGGTCGTAAACCTCGAGGTTTACGACCTCAATCCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1342s21c1
Sequence:CCGGTACAACAACCTGTGGATTATCCTCGAGGATAATCCACAGGTTGTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-927s21c1
Sequence:CCGGCAAGTTTGTTGGCCTCTTTATCTCGAGATAAAGAGGCCAACAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-993s21c1
Sequence:CCGGGTTCGGAGACCTCAGTCTTTCCTCGAGGAAAGACTGAGGTCTCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1102s21c1
Sequence:CCGGCACTTCATGGTGCTGAGTAAACTCGAGTTTACTCAGCACCATGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1416s21c1
Sequence:CCGGTGTAAGACATGGAGACATTATCTCGAGATAATGTCTCCATGTCTTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1952s21c1
Sequence:CCGGACACAGATTTCCGAGTCTATCCTCGAGGATAGACTCGGAAATCTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013382
VALIDATED
POMT2 MISSION shRNA shRNA Plasmid DNA
protein-O-mannosyltransferase 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013382.3-1904s1c1
Sequence:CCGGCCTATCAACTATCAGGGCCTACTCGAGTAGGCCCTGATAGTTGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-1067s1c1
Sequence:CCGGGCTCTCTATACAGCCACCTTTCTCGAGAAAGGTGGCTGTATAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-1454s1c1
Sequence:CCGGCGGAACTTGCACAGTCACTATCTCGAGATAGTGACTGTGCAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-2135s1c1
Sequence:CCGGACACTCCATTACTTCCCGTTTCTCGAGAAACGGGAAGTAATGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013382.3-471s1c1
Sequence:CCGGGAAGTTACTATATCAACCGTACTCGAGTACGGTTGATATAGTAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1561s21c1
Sequence:CCGGTGGCGGATTGAGGTCGTAAACCTCGAGGTTTACGACCTCAATCCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1342s21c1
Sequence:CCGGTACAACAACCTGTGGATTATCCTCGAGGATAATCCACAGGTTGTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-927s21c1
Sequence:CCGGCAAGTTTGTTGGCCTCTTTATCTCGAGATAAAGAGGCCAACAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-993s21c1
Sequence:CCGGGTTCGGAGACCTCAGTCTTTCCTCGAGGAAAGACTGAGGTCTCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1102s21c1
Sequence:CCGGCACTTCATGGTGCTGAGTAAACTCGAGTTTACTCAGCACCATGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1416s21c1
Sequence:CCGGTGTAAGACATGGAGACATTATCTCGAGATAATGTCTCCATGTCTTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1952s21c1
Sequence:CCGGACACAGATTTCCGAGTCTATCCTCGAGGATAGACTCGGAAATCTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013382
VALIDATED
POMT2 MISSION shRNA Lentiviral Transduction Particles
protein-O-mannosyltransferase 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013382.3-1904s1c1
Sequence:CCGGCCTATCAACTATCAGGGCCTACTCGAGTAGGCCCTGATAGTTGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-1067s1c1
Sequence:CCGGGCTCTCTATACAGCCACCTTTCTCGAGAAAGGTGGCTGTATAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-1454s1c1
Sequence:CCGGCGGAACTTGCACAGTCACTATCTCGAGATAGTGACTGTGCAAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_013382.3-2135s1c1
Sequence:CCGGACACTCCATTACTTCCCGTTTCTCGAGAAACGGGAAGTAATGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013382.3-471s1c1
Sequence:CCGGGAAGTTACTATATCAACCGTACTCGAGTACGGTTGATATAGTAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1561s21c1
Sequence:CCGGTGGCGGATTGAGGTCGTAAACCTCGAGGTTTACGACCTCAATCCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1342s21c1
Sequence:CCGGTACAACAACCTGTGGATTATCCTCGAGGATAATCCACAGGTTGTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-927s21c1
Sequence:CCGGCAAGTTTGTTGGCCTCTTTATCTCGAGATAAAGAGGCCAACAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-993s21c1
Sequence:CCGGGTTCGGAGACCTCAGTCTTTCCTCGAGGAAAGACTGAGGTCTCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1102s21c1
Sequence:CCGGCACTTCATGGTGCTGAGTAAACTCGAGTTTACTCAGCACCATGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1416s21c1
Sequence:CCGGTGTAAGACATGGAGACATTATCTCGAGATAATGTCTCCATGTCTTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013382.5-1952s21c1
Sequence:CCGGACACAGATTTCCGAGTCTATCCTCGAGGATAGACTCGGAAATCTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153415
VALIDATED
POMT2 MISSION shRNA Bacterial Glycerol Stock
protein-O-mannosyltransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153415.1-2491s1c1
Sequence:CCGGCCTGGACTTAACTAAATACTACTCGAGTAGTATTTAGTTAAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-1198s1c1
Sequence:CCGGGCAGCAGGTTACCACCTATTTCTCGAGAAATAGGTGGTAACCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-2109s1c1
Sequence:CCGGGCATGTTGACAGGTATCCTATCTCGAGATAGGATACCTGTCAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153415.1-2032s1c1
Sequence:CCGGGCTCCATTACTTCCCTTTCTTCTCGAGAAGAAAGGGAAGTAATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-646s1c1
Sequence:CCGGCCTCACTCTATCCCAGTACATCTCGAGATGTACTGGGATAGAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153415.3-2887s21c1
Sequence:CCGGCCTGGACTTAACTAAATACTACTCGAGTAGTATTTAGTTAAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1594s21c1
Sequence:CCGGGCAGCAGGTTACCACCTATTTCTCGAGAAATAGGTGGTAACCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-2185s21c1
Sequence:CCGGCTGGCACTGGCCTATCAATTACTCGAGTAATTGATAGGCCAGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1990s21c1
Sequence:CCGGTACCTGTACTCCGTACCTAAACTCGAGTTTAGGTACGGAGTACAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1799s21c1
Sequence:CCGGGTCACTGGCTATGGCATAAATCTCGAGATTTATGCCATAGCCAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153415
VALIDATED
POMT2 MISSION shRNA shRNA Plasmid DNA
protein-O-mannosyltransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153415.1-2491s1c1
Sequence:CCGGCCTGGACTTAACTAAATACTACTCGAGTAGTATTTAGTTAAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-1198s1c1
Sequence:CCGGGCAGCAGGTTACCACCTATTTCTCGAGAAATAGGTGGTAACCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-2109s1c1
Sequence:CCGGGCATGTTGACAGGTATCCTATCTCGAGATAGGATACCTGTCAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153415.1-2032s1c1
Sequence:CCGGGCTCCATTACTTCCCTTTCTTCTCGAGAAGAAAGGGAAGTAATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-646s1c1
Sequence:CCGGCCTCACTCTATCCCAGTACATCTCGAGATGTACTGGGATAGAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153415.3-2887s21c1
Sequence:CCGGCCTGGACTTAACTAAATACTACTCGAGTAGTATTTAGTTAAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1594s21c1
Sequence:CCGGGCAGCAGGTTACCACCTATTTCTCGAGAAATAGGTGGTAACCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-2185s21c1
Sequence:CCGGCTGGCACTGGCCTATCAATTACTCGAGTAATTGATAGGCCAGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1990s21c1
Sequence:CCGGTACCTGTACTCCGTACCTAAACTCGAGTTTAGGTACGGAGTACAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1799s21c1
Sequence:CCGGGTCACTGGCTATGGCATAAATCTCGAGATTTATGCCATAGCCAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153415
VALIDATED
POMT2 MISSION shRNA Lentiviral Transduction Particles
protein-O-mannosyltransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153415.1-2491s1c1
Sequence:CCGGCCTGGACTTAACTAAATACTACTCGAGTAGTATTTAGTTAAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-1198s1c1
Sequence:CCGGGCAGCAGGTTACCACCTATTTCTCGAGAAATAGGTGGTAACCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-2109s1c1
Sequence:CCGGGCATGTTGACAGGTATCCTATCTCGAGATAGGATACCTGTCAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153415.1-2032s1c1
Sequence:CCGGGCTCCATTACTTCCCTTTCTTCTCGAGAAGAAAGGGAAGTAATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153415.1-646s1c1
Sequence:CCGGCCTCACTCTATCCCAGTACATCTCGAGATGTACTGGGATAGAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153415.3-2887s21c1
Sequence:CCGGCCTGGACTTAACTAAATACTACTCGAGTAGTATTTAGTTAAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1594s21c1
Sequence:CCGGGCAGCAGGTTACCACCTATTTCTCGAGAAATAGGTGGTAACCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-2185s21c1
Sequence:CCGGCTGGCACTGGCCTATCAATTACTCGAGTAATTGATAGGCCAGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1990s21c1
Sequence:CCGGTACCTGTACTCCGTACCTAAACTCGAGTTTAGGTACGGAGTACAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153415.3-1799s21c1
Sequence:CCGGGTCACTGGCTATGGCATAAATCTCGAGATTTATGCCATAGCCAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)