EMAIL THIS PAGE TO A FRIEND

PON1

paraoxonase 1

60 Gene Product Result for
Synonyms: ESA MVCD5 PON
UniProtKB ID: P27169, B2RA40, Q16052, Q6B0J6, Q9UCB1
Gene ID:
Human(5444) Summary: The enzyme encoded by this gene is an arylesterase that mainly hydrolyzes paroxon to produce p-nitrophenol. Paroxon is an organophosphorus anticholinesterase compound that is produced in vivo by oxidation of the insecticide parathion. Polymorphisms in this gene are a risk factor in coronary artery disease. The gene is found in a cluster of three related paraoxonase genes at 7q21.3. [provided by RefSeq, Oct 2008]
Mouse(18979) paraoxonase 1
Rat(84024) paraoxonase 1
Zebrafish(447803) paraoxonase 1
dog(475234) paraoxonase 1
domestic cat(101091522) paraoxonase 1
cow(523798) paraoxonase 1
sheep(101116983) paraoxonase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0547 AQUA Peptide YVYIAELLAH[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000446 Rosetta Predictions human pricing
NM_032077 Rosetta Predictions rat pricing
NM_011134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242728 predicted 647
2 SASI_Hs01_00242729 predicted 428
3 SASI_Hs01_00242730 predicted 827
4 SASI_Hs01_00242731 predicted 667
5 SASI_Hs01_00242732 predicted 774
6 SASI_Hs01_00242733 predicted 544
7 SASI_Hs01_00242734 predicted 766
8 SASI_Hs01_00242735 predicted 994
9 SASI_Hs01_00242736 predicted 414
10 SASI_Hs01_00242737 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265444 predicted 955
2 SASI_Rn01_00079574 predicted 972
3 SASI_Rn01_00079575 predicted 728
4 SASI_Rn01_00079576 predicted 310
5 SASI_Rn01_00079577 predicted 328
6 SASI_Rn01_00079578 predicted 717
7 SASI_Rn01_00079579 predicted 513
8 SASI_Rn01_00079581 predicted 299
9 SASI_Rn01_00079582 predicted 710
10 SASI_Rn01_00079583 predicted 658
11 SASI_Rn01_00079580 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032583 predicted 838
2 SASI_Mm01_00032584 predicted 369
3 SASI_Mm01_00032585 predicted 982
4 SASI_Mm01_00032586 predicted 227
5 SASI_Mm01_00032588 predicted 770
6 SASI_Mm01_00032589 predicted 781
7 SASI_Mm02_00319961 predicted 860
8 SASI_Mm01_00032590 predicted 1120
9 SASI_Mm01_00032592 predicted 206
10 SASI_Mm02_00319962 predicted 429
11 SASI_Mm01_00032587 predicted 526
12 SASI_Mm01_00032591 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000446
PON1 MISSION shRNA Bacterial Glycerol Stock
paraoxonase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000446.5-762s21c1
Sequence:CCGGTTGCTAATGGAATCAACATTTCTCGAGAAATGTTGATTCCATTAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000446.5-1253s21c1
Sequence:CCGGCAATGAATGCTGACCCTAAATCTCGAGATTTAGGGTCAGCATTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000446.5-1156s21c1
Sequence:CCGGTGAGCTCTAACAGACCGATTTCTCGAGAAATCGGTCTGTTAGAGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-781s1c1
Sequence:CCGGGCTCATAAGATTCATGTGTATCTCGAGATACACATGAATCTTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-1000s1c1
Sequence:CCGGCCTAAAGTGACACAGGTTTATCTCGAGATAAACCTGTGTCACTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-122s1c1
Sequence:CCGGCTTCTTACCAAACACGACTTACTCGAGTAAGTCGTGTTTGGTAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-745s1c1
Sequence:CCGGCCCGATGGCAAGTATGTCTATCTCGAGATAGACATACTTGCCATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-244s1c1
Sequence:CCGGGCTTTCATTAGCTCTGGATTACTCGAGTAATCCAGAGCTAATGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000446
PON1 MISSION shRNA shRNA Plasmid DNA
paraoxonase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000446.5-762s21c1
Sequence:CCGGTTGCTAATGGAATCAACATTTCTCGAGAAATGTTGATTCCATTAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000446.5-1253s21c1
Sequence:CCGGCAATGAATGCTGACCCTAAATCTCGAGATTTAGGGTCAGCATTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000446.5-1156s21c1
Sequence:CCGGTGAGCTCTAACAGACCGATTTCTCGAGAAATCGGTCTGTTAGAGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-781s1c1
Sequence:CCGGGCTCATAAGATTCATGTGTATCTCGAGATACACATGAATCTTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-1000s1c1
Sequence:CCGGCCTAAAGTGACACAGGTTTATCTCGAGATAAACCTGTGTCACTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-122s1c1
Sequence:CCGGCTTCTTACCAAACACGACTTACTCGAGTAAGTCGTGTTTGGTAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-745s1c1
Sequence:CCGGCCCGATGGCAAGTATGTCTATCTCGAGATAGACATACTTGCCATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-244s1c1
Sequence:CCGGGCTTTCATTAGCTCTGGATTACTCGAGTAATCCAGAGCTAATGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000446
PON1 MISSION shRNA Lentiviral Transduction Particles
paraoxonase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000446.5-762s21c1
Sequence:CCGGTTGCTAATGGAATCAACATTTCTCGAGAAATGTTGATTCCATTAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000446.5-1253s21c1
Sequence:CCGGCAATGAATGCTGACCCTAAATCTCGAGATTTAGGGTCAGCATTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000446.5-1156s21c1
Sequence:CCGGTGAGCTCTAACAGACCGATTTCTCGAGAAATCGGTCTGTTAGAGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-781s1c1
Sequence:CCGGGCTCATAAGATTCATGTGTATCTCGAGATACACATGAATCTTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-1000s1c1
Sequence:CCGGCCTAAAGTGACACAGGTTTATCTCGAGATAAACCTGTGTCACTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-122s1c1
Sequence:CCGGCTTCTTACCAAACACGACTTACTCGAGTAAGTCGTGTTTGGTAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-745s1c1
Sequence:CCGGCCCGATGGCAAGTATGTCTATCTCGAGATAGACATACTTGCCATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000446.3-244s1c1
Sequence:CCGGGCTTTCATTAGCTCTGGATTACTCGAGTAATCCAGAGCTAATGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011134
PON1 MISSION shRNA Bacterial Glycerol Stock
paraoxonase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011134.1-1178s1c1
Sequence:CCGGGAGGCCATTATTTCAATCCTTCTCGAGAAGGATTGAAATAATGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-803s1c1
Sequence:CCGGGCTCACAAGATTCATGTGTATCTCGAGATACACATGAATCTTGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-935s1c1
Sequence:CCGGCCCAACGGAATGAGGATCTTTCTCGAGAAAGATCCTCATTCCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-173s1c1
Sequence:CCGGCGTGAAGTAACGCCAGTAGAACTCGAGTTCTACTGGCGTTACTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-568s1c1
Sequence:CCGGTCTGCCTAGCATCAACGATATCTCGAGATATCGTTGATGCTAGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011134
PON1 MISSION shRNA shRNA Plasmid DNA
paraoxonase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011134.1-1178s1c1
Sequence:CCGGGAGGCCATTATTTCAATCCTTCTCGAGAAGGATTGAAATAATGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-803s1c1
Sequence:CCGGGCTCACAAGATTCATGTGTATCTCGAGATACACATGAATCTTGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-935s1c1
Sequence:CCGGCCCAACGGAATGAGGATCTTTCTCGAGAAAGATCCTCATTCCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-173s1c1
Sequence:CCGGCGTGAAGTAACGCCAGTAGAACTCGAGTTCTACTGGCGTTACTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-568s1c1
Sequence:CCGGTCTGCCTAGCATCAACGATATCTCGAGATATCGTTGATGCTAGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011134
PON1 MISSION shRNA Lentiviral Transduction Particles
paraoxonase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011134.1-1178s1c1
Sequence:CCGGGAGGCCATTATTTCAATCCTTCTCGAGAAGGATTGAAATAATGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-803s1c1
Sequence:CCGGGCTCACAAGATTCATGTGTATCTCGAGATACACATGAATCTTGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-935s1c1
Sequence:CCGGCCCAACGGAATGAGGATCTTTCTCGAGAAAGATCCTCATTCCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-173s1c1
Sequence:CCGGCGTGAAGTAACGCCAGTAGAACTCGAGTTCTACTGGCGTTACTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011134.1-568s1c1
Sequence:CCGGTCTGCCTAGCATCAACGATATCTCGAGATATCGTTGATGCTAGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)