EMAIL THIS PAGE TO A FRIEND

PON2

paraoxonase 2

95 Gene Product Result for
Gene ID:
Human(5445) Summary: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(330260) paraoxonase 2
Rat(296851) paraoxonase 2
cow(281417) paraoxonase 2
sheep(100145861) paraoxonase 2
Zebrafish(335176) paraoxonase 2
chicken(395830) paraoxonase 2
dog(403855) paraoxonase 2
domestic cat(101094492) paraoxonase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000305 Rosetta Predictions human pricing
NM_001018161 Rosetta Predictions human pricing
NM_001013082 Rosetta Predictions rat pricing
NM_183308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180527 predicted 1193
2 SASI_Hs01_00180528 predicted 1073
3 SASI_Hs01_00180529 predicted 790
4 SASI_Hs01_00180531 predicted 899
5 SASI_Hs02_00302294 predicted 1035
6 SASI_Hs01_00180532 predicted 863
7 SASI_Hs01_00180533 predicted 1202
8 SASI_Hs01_00180534 predicted 860
9 SASI_Hs01_00180535 predicted 984
10 SASI_Hs01_00180536 predicted 1034
11 SASI_Hs01_00180530 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139912 predicted 1155
2 SASI_Hs01_00139913 predicted 1038
3 SASI_Hs01_00139914 predicted 759
4 SASI_Hs01_00139916 predicted 864
5 SASI_Hs02_00307048 predicted 1005
6 SASI_Hs01_00139917 predicted 831
7 SASI_Hs01_00139918 predicted 1171
8 SASI_Hs01_00139919 predicted 824
9 SASI_Hs01_00139920 predicted 948
10 SASI_Hs01_00139921 predicted 994
11 SASI_Hs01_00139915 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103230 predicted 799
2 SASI_Rn01_00103231 predicted 637
3 SASI_Rn01_00103232 predicted 719
4 SASI_Rn01_00103233 predicted 207
5 SASI_Rn01_00103234 predicted 389
6 SASI_Rn01_00103235 predicted 299
7 SASI_Rn01_00103236 predicted 851
8 SASI_Rn01_00103237 predicted 425
9 SASI_Rn01_00103238 predicted 224
10 SASI_Rn01_00103239 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350422 predicted 796
2 SASI_Mm01_00185066 predicted 838
3 SASI_Mm01_00185067 predicted 324
4 SASI_Mm01_00185070 predicted 756
5 SASI_Mm01_00185071 predicted 400
6 SASI_Mm01_00185072 predicted 423
7 SASI_Mm01_00185073 predicted 240
8 SASI_Mm01_00185074 predicted 212
9 SASI_Mm01_00185075 predicted 971
10 SASI_Mm02_00350423 predicted 627
11 SASI_Mm01_00185068 predicted 797
12 SASI_Mm01_00185069 predicted 1033
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000305
VALIDATED
PON2 MISSION shRNA Bacterial Glycerol Stock
paraoxonase 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000305.2-644s21c1
Sequence:CCGGGCACATTTCTATGCCACAAATCTCGAGATTTGTGGCATAGAAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-555s1c1
Sequence:CCGGGCACATTTCTATGCCACAAATCTCGAGATTTGTGGCATAGAAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000305.1-578s1c1
Sequence:CCGGCCACTACTTCTCTGATCCTTTCTCGAGAAAGGATCAGAGAAGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-1049s1c1
Sequence:CCGGGCTGCTCATAGGCACTTTATACTCGAGTATAAAGTGCCTATGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-980s1c1
Sequence:CCGGGACTACAGTTTATGCCAACAACTCGAGTTGTTGGCATAAACTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-99s1c1
Sequence:CCGGGCACTCAGAAATCGACTTAAACTCGAGTTTAAGTCGATTTCTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000305
VALIDATED
PON2 MISSION shRNA shRNA Plasmid DNA
paraoxonase 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000305.2-644s21c1
Sequence:CCGGGCACATTTCTATGCCACAAATCTCGAGATTTGTGGCATAGAAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-555s1c1
Sequence:CCGGGCACATTTCTATGCCACAAATCTCGAGATTTGTGGCATAGAAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000305.1-578s1c1
Sequence:CCGGCCACTACTTCTCTGATCCTTTCTCGAGAAAGGATCAGAGAAGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-1049s1c1
Sequence:CCGGGCTGCTCATAGGCACTTTATACTCGAGTATAAAGTGCCTATGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-980s1c1
Sequence:CCGGGACTACAGTTTATGCCAACAACTCGAGTTGTTGGCATAAACTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-99s1c1
Sequence:CCGGGCACTCAGAAATCGACTTAAACTCGAGTTTAAGTCGATTTCTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000305
VALIDATED
PON2 MISSION shRNA Lentiviral Transduction Particles
paraoxonase 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000305.2-644s21c1
Sequence:CCGGGCACATTTCTATGCCACAAATCTCGAGATTTGTGGCATAGAAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-555s1c1
Sequence:CCGGGCACATTTCTATGCCACAAATCTCGAGATTTGTGGCATAGAAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000305.1-578s1c1
Sequence:CCGGCCACTACTTCTCTGATCCTTTCTCGAGAAAGGATCAGAGAAGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-1049s1c1
Sequence:CCGGGCTGCTCATAGGCACTTTATACTCGAGTATAAAGTGCCTATGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-980s1c1
Sequence:CCGGGACTACAGTTTATGCCAACAACTCGAGTTGTTGGCATAAACTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000305.1-99s1c1
Sequence:CCGGGCACTCAGAAATCGACTTAAACTCGAGTTTAAGTCGATTTCTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183308
PON2 MISSION shRNA Bacterial Glycerol Stock
paraoxonase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-1085s1c1
Sequence:CCGGGCGACCATATATGATAGGAAACTCGAGTTTCCTATCATATATGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-242s1c1
Sequence:CCGGGCTGAGGACATTGACATTCTTCTCGAGAAGAATGTCAATGTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-884s1c1
Sequence:CCGGCTGGTGGACAATTTATCTATTCTCGAGAATAGATAAATTGTCCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-655s1c1
Sequence:CCGGCTTGAAGTATTTGGAGACATACTCGAGTATGTCTCCAAATACTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-167s1c1
Sequence:CCGGCGACTTAAAGCCTCCAGAGAACTCGAGTTCTCTGGAGGCTTTAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183308
PON2 MISSION shRNA shRNA Plasmid DNA
paraoxonase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-1085s1c1
Sequence:CCGGGCGACCATATATGATAGGAAACTCGAGTTTCCTATCATATATGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-242s1c1
Sequence:CCGGGCTGAGGACATTGACATTCTTCTCGAGAAGAATGTCAATGTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-884s1c1
Sequence:CCGGCTGGTGGACAATTTATCTATTCTCGAGAATAGATAAATTGTCCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-655s1c1
Sequence:CCGGCTTGAAGTATTTGGAGACATACTCGAGTATGTCTCCAAATACTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-167s1c1
Sequence:CCGGCGACTTAAAGCCTCCAGAGAACTCGAGTTCTCTGGAGGCTTTAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183308
PON2 MISSION shRNA Lentiviral Transduction Particles
paraoxonase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-1085s1c1
Sequence:CCGGGCGACCATATATGATAGGAAACTCGAGTTTCCTATCATATATGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-242s1c1
Sequence:CCGGGCTGAGGACATTGACATTCTTCTCGAGAAGAATGTCAATGTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-884s1c1
Sequence:CCGGCTGGTGGACAATTTATCTATTCTCGAGAATAGATAAATTGTCCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-655s1c1
Sequence:CCGGCTTGAAGTATTTGGAGACATACTCGAGTATGTCTCCAAATACTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183308.1-167s1c1
Sequence:CCGGCGACTTAAAGCCTCCAGAGAACTCGAGTTCTCTGGAGGCTTTAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)