EMAIL THIS PAGE TO A FRIEND

POP4

processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)

48 Gene Product Result for
Synonyms: RPP29
UniProtKB ID: O95707, Q5XKL7, Q6FHW9, Q9UQQ3
Gene ID:
Human(10775) Summary: This gene encodes one of the protein subunits of the small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is localized to the nucleus and associates directly with the RNA component of these complexes. This protein is involved in processing of precursor RNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Mouse(66161) processing of precursor 4, ribonuclease P/MRP family, (S. cerevisiae)
Rat(292831) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Zebrafish(553787) processing of precursor 4, ribonuclease P/MRP subunit
chicken(768362) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
dog(612732) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
domestic cat(101094066) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
domestic guinea pig(100718659) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
naked mole-rat(101709670) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
cow(614870) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
sheep(101106353) processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40674 Anti-POP4 antibody produced in rabbit IgG fraction of antiserum human, rabbit, horse, dog, bovine, guinea pig, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006627 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006627 Rosetta Predictions human pricing
NM_001009642 Rosetta Predictions rat pricing
NM_025390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067704 predicted 461
2 SASI_Hs01_00067706 predicted 385
3 SASI_Hs01_00067707 predicted 473
4 SASI_Hs01_00067709 predicted 353
5 SASI_Hs01_00067710 predicted 410
6 SASI_Hs01_00067711 predicted 275
7 SASI_Hs01_00067712 predicted 324
8 SASI_Hs01_00067713 predicted 330
9 SASI_Hs02_00341972 predicted 479
10 SASI_Hs02_00341973 predicted 271
11 SASI_Hs01_00067705 predicted 409
12 SASI_Hs01_00067708 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068151 predicted 676
2 SASI_Rn01_00068152 predicted 566
3 SASI_Rn01_00068153 predicted 662
4 SASI_Rn01_00068154 predicted 802
5 SASI_Rn01_00068155 predicted 779
6 SASI_Rn02_00199662 predicted 526
7 SASI_Rn01_00068156 predicted 867
8 SASI_Rn01_00068157 predicted 752
9 SASI_Rn01_00068158 predicted 703
10 SASI_Rn01_00068159 predicted 598
11 SASI_Rn01_00068160 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023789 predicted 366
2 SASI_Mm01_00023790 predicted 441
3 SASI_Mm01_00023791 predicted 675
4 SASI_Mm01_00023792 predicted 814
5 SASI_Mm01_00023793 predicted 901
6 SASI_Mm01_00023794 predicted 868
7 SASI_Mm01_00023795 predicted 562
8 SASI_Mm01_00023796 predicted 600
9 SASI_Mm01_00023797 predicted 786
10 SASI_Mm01_00023798 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025390
VALIDATED
POP4 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-448s21c1
Sequence:CCGGATGCGGCTCTTTGACATTAAACTCGAGTTTAATGTCAAAGAGCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025390.4-886s21c1
Sequence:CCGGCCTGACACTGAAGAACTGGAACTCGAGTTCCAGTTCTTCAGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-504s21c1
Sequence:CCGGCCATGAACTCTGGAAACAGTACTCGAGTACTGTTTCCAGAGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-357s21c1
Sequence:CCGGGGCCGTGATCTTGGAATATTTCTCGAGAAATATTCCAAGATCACGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-505s1c1
Sequence:CCGGCCATGAACTCTGGAAACAGTACTCGAGTACTGTTTCCAGAGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-887s1c1
Sequence:CCGGCCTGACACTGAAGAACTGGAACTCGAGTTCCAGTTCTTCAGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025390.2-777s1c1
Sequence:CCGGCCTACATTTATGGAAGCAAATCTCGAGATTTGCTTCCATAAATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-475s1c1
Sequence:CCGGGCAACAGAGATACAGCCTGTTCTCGAGAACAGGCTGTATCTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-611s1c1
Sequence:CCGGGCTATTATTTCAGTCACGAAACTCGAGTTTCGTGACTGAAATAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-474s21c1
Sequence:CCGGGCAACAGAGATACAGCCTGTTCTCGAGAACAGGCTGTATCTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025390
VALIDATED
POP4 MISSION shRNA shRNA Plasmid DNA
processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-448s21c1
Sequence:CCGGATGCGGCTCTTTGACATTAAACTCGAGTTTAATGTCAAAGAGCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025390.4-886s21c1
Sequence:CCGGCCTGACACTGAAGAACTGGAACTCGAGTTCCAGTTCTTCAGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-504s21c1
Sequence:CCGGCCATGAACTCTGGAAACAGTACTCGAGTACTGTTTCCAGAGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-357s21c1
Sequence:CCGGGGCCGTGATCTTGGAATATTTCTCGAGAAATATTCCAAGATCACGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-505s1c1
Sequence:CCGGCCATGAACTCTGGAAACAGTACTCGAGTACTGTTTCCAGAGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-887s1c1
Sequence:CCGGCCTGACACTGAAGAACTGGAACTCGAGTTCCAGTTCTTCAGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025390.2-777s1c1
Sequence:CCGGCCTACATTTATGGAAGCAAATCTCGAGATTTGCTTCCATAAATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-475s1c1
Sequence:CCGGGCAACAGAGATACAGCCTGTTCTCGAGAACAGGCTGTATCTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-611s1c1
Sequence:CCGGGCTATTATTTCAGTCACGAAACTCGAGTTTCGTGACTGAAATAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-474s21c1
Sequence:CCGGGCAACAGAGATACAGCCTGTTCTCGAGAACAGGCTGTATCTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025390
VALIDATED
POP4 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-448s21c1
Sequence:CCGGATGCGGCTCTTTGACATTAAACTCGAGTTTAATGTCAAAGAGCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025390.4-886s21c1
Sequence:CCGGCCTGACACTGAAGAACTGGAACTCGAGTTCCAGTTCTTCAGTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-504s21c1
Sequence:CCGGCCATGAACTCTGGAAACAGTACTCGAGTACTGTTTCCAGAGTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-357s21c1
Sequence:CCGGGGCCGTGATCTTGGAATATTTCTCGAGAAATATTCCAAGATCACGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-505s1c1
Sequence:CCGGCCATGAACTCTGGAAACAGTACTCGAGTACTGTTTCCAGAGTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-887s1c1
Sequence:CCGGCCTGACACTGAAGAACTGGAACTCGAGTTCCAGTTCTTCAGTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025390.2-777s1c1
Sequence:CCGGCCTACATTTATGGAAGCAAATCTCGAGATTTGCTTCCATAAATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-475s1c1
Sequence:CCGGGCAACAGAGATACAGCCTGTTCTCGAGAACAGGCTGTATCTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025390.2-611s1c1
Sequence:CCGGGCTATTATTTCAGTCACGAAACTCGAGTTTCGTGACTGAAATAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025390.4-474s21c1
Sequence:CCGGGCAACAGAGATACAGCCTGTTCTCGAGAACAGGCTGTATCTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006627
VALIDATED
POP4 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-676s21c1
Sequence:CCGGGGTCTGCGAAGAAGTTCAAAGCTCGAGCTTTGAACTTCTTCGCAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-560s21c1
Sequence:CCGGCACCAAAGAAGACCGCCTGAACTCGAGTTCAGGCGGTCTTCTTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-999s21c1
Sequence:CCGGGTTGACTTGAATAGGATTATTCTCGAGAATAATCCTATTCAAGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-603s1c1
Sequence:CCGGCCTACATTTACGGGAGCAAATCTCGAGATTTGCTCCCGTAAATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-498s21c1
Sequence:CCGGCCCTCTTATGTGGGTATTACACTCGAGTGTAATACCCACATAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-84s21c1
Sequence:CCGGTCTCAGAAAGAGGCGAATGACCTCGAGGTCATTCGCCTCTTTCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-326s1c1
Sequence:CCGGCCTCTCCATGAACTCTGGAAACTCGAGTTTCCAGAGTTCATGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006627.1-589s1c1
Sequence:CCGGCGATGGCTTTATTTCCTACATCTCGAGATGTAGGAAATAAAGCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-275s1c1
Sequence:CCGGCTGCGGCTCTTTGACATTAAACTCGAGTTTAATGTCAAAGAGCCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-467s1c1
Sequence:CCGGCCCTCTTATGTGGGTATTACACTCGAGTGTAATACCCACATAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006627
VALIDATED
POP4 MISSION shRNA shRNA Plasmid DNA
processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-676s21c1
Sequence:CCGGGGTCTGCGAAGAAGTTCAAAGCTCGAGCTTTGAACTTCTTCGCAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-560s21c1
Sequence:CCGGCACCAAAGAAGACCGCCTGAACTCGAGTTCAGGCGGTCTTCTTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-999s21c1
Sequence:CCGGGTTGACTTGAATAGGATTATTCTCGAGAATAATCCTATTCAAGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-603s1c1
Sequence:CCGGCCTACATTTACGGGAGCAAATCTCGAGATTTGCTCCCGTAAATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-498s21c1
Sequence:CCGGCCCTCTTATGTGGGTATTACACTCGAGTGTAATACCCACATAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-84s21c1
Sequence:CCGGTCTCAGAAAGAGGCGAATGACCTCGAGGTCATTCGCCTCTTTCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-326s1c1
Sequence:CCGGCCTCTCCATGAACTCTGGAAACTCGAGTTTCCAGAGTTCATGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006627.1-589s1c1
Sequence:CCGGCGATGGCTTTATTTCCTACATCTCGAGATGTAGGAAATAAAGCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-275s1c1
Sequence:CCGGCTGCGGCTCTTTGACATTAAACTCGAGTTTAATGTCAAAGAGCCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-467s1c1
Sequence:CCGGCCCTCTTATGTGGGTATTACACTCGAGTGTAATACCCACATAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006627
VALIDATED
POP4 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-676s21c1
Sequence:CCGGGGTCTGCGAAGAAGTTCAAAGCTCGAGCTTTGAACTTCTTCGCAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-560s21c1
Sequence:CCGGCACCAAAGAAGACCGCCTGAACTCGAGTTCAGGCGGTCTTCTTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-999s21c1
Sequence:CCGGGTTGACTTGAATAGGATTATTCTCGAGAATAATCCTATTCAAGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-603s1c1
Sequence:CCGGCCTACATTTACGGGAGCAAATCTCGAGATTTGCTCCCGTAAATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-498s21c1
Sequence:CCGGCCCTCTTATGTGGGTATTACACTCGAGTGTAATACCCACATAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006627.2-84s21c1
Sequence:CCGGTCTCAGAAAGAGGCGAATGACCTCGAGGTCATTCGCCTCTTTCTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-326s1c1
Sequence:CCGGCCTCTCCATGAACTCTGGAAACTCGAGTTTCCAGAGTTCATGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006627.1-589s1c1
Sequence:CCGGCGATGGCTTTATTTCCTACATCTCGAGATGTAGGAAATAAAGCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-275s1c1
Sequence:CCGGCTGCGGCTCTTTGACATTAAACTCGAGTTTAATGTCAAAGAGCCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006627.1-467s1c1
Sequence:CCGGCCCTCTTATGTGGGTATTACACTCGAGTGTAATACCCACATAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)