EMAIL THIS PAGE TO A FRIEND

POP5

processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)

59 Gene Product Result for
Synonyms: HSPC004 RPP2 RPP20 hPop5
UniProtKB ID: Q969H6, A6NL80, Q53FS5, Q9Y2Q6
Gene ID:
Mouse(117109) processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae)
Rat(117241) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
cow(507410) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
sheep(101119586) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
naked mole-rat(101725877) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
domestic guinea pig(100729028) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Zebrafish(541421) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
chicken(416973) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
domestic cat(101097179) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
dog(477515) processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106006 Anti-POP5 antibody produced in rabbit affinity isolated antibody human, dog, rat, horse, guinea pig, mouse
western blot pricing
SAB2106007 Anti-POP5 antibody produced in rabbit affinity isolated antibody rat, rabbit, bovine, sheep, horse, mouse, human, guinea pig
western blot pricing
HPA047598 Anti-POP5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064841 MISSION® esiRNA esiRNA human POP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015918 Rosetta Predictions human pricing
NM_198202 Rosetta Predictions human pricing
NM_001105752 Rosetta Predictions rat pricing
NM_026398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181092 predicted 449
2 SASI_Hs01_00181093 predicted 387
3 SASI_Hs02_00348533 predicted 450
4 SASI_Hs01_00181094 predicted 554
5 SASI_Hs01_00181095 predicted 384
6 SASI_Hs01_00181096 predicted 351
7 SASI_Hs02_00348534 predicted 408
8 SASI_Hs01_00181097 predicted 216
9 SASI_Hs01_00181098 predicted 334
10 SASI_Hs01_00181100 predicted 436
11 SASI_Hs01_00181091 predicted 395
12 SASI_Hs01_00181099 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048970 predicted 307
2 SASI_Hs01_00048971 predicted 234
3 SASI_Hs01_00048972 predicted 302
4 SASI_Hs02_00371737 predicted 411
5 SASI_Hs01_00048973 predicted 236
6 SASI_Hs01_00048974 predicted 204
7 SASI_Hs01_00048975 predicted 241
8 SASI_Hs01_00048977 predicted 406
9 SASI_Hs01_00048978 predicted 287
10 SASI_Hs01_00048979 predicted 357
11 SASI_Hs01_00048976 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212186 predicted 778
2 SASI_Rn02_00212187 predicted 718
3 SASI_Rn02_00212188 predicted 782
4 SASI_Rn02_00212189 predicted 778
5 SASI_Rn02_00212190 predicted 667
6 SASI_Rn02_00212191 predicted 728
7 SASI_Rn02_00212192 predicted 764
8 SASI_Rn02_00212193 predicted 674
9 SASI_Rn02_00212194 predicted 674
10 SASI_Rn02_00212195 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138560 predicted 536
2 SASI_Mm02_00330174 predicted 622
3 SASI_Mm02_00330175 predicted 535
4 SASI_Mm01_00138562 predicted 590
5 SASI_Mm01_00138563 predicted 617
6 SASI_Mm01_00138564 predicted 532
7 SASI_Mm01_00138565 predicted 504
8 SASI_Mm01_00138566 predicted 451
9 SASI_Mm01_00138567 predicted 750
10 SASI_Mm01_00138568 predicted 568
11 SASI_Mm01_00138561 predicted 573
12 SASI_Mm01_00138569 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015918
VALIDATED
POP5 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-340s1c1
Sequence:CCGGTGGGAGGTACAATAAGAACATCTCGAGATGTTCTTATTGTACCTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-281s1c1
Sequence:CCGGCATCACATACTTGGAGAACAACTCGAGTTGTTCTCCAAGTATGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-195s1c1
Sequence:CCGGGTTCGATATCTCAATGCCTATCTCGAGATAGGCATTGAGATATCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015918.3-365s21c1
Sequence:CCGGGAAGTTCCTAATTCAGTACAACTCGAGTTGTACTGAATTAGGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-365s1c1
Sequence:CCGGGAAGTTCCTAATTCAGTACAACTCGAGTTGTACTGAATTAGGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-454s1c1
Sequence:CCGGCTGTGACAAGAAGCTGCTTATCTCGAGATAAGCAGCTTCTTGTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-281s21c1
Sequence:CCGGCATCACATACTTGGAGAACAACTCGAGTTGTTCTCCAAGTATGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-454s21c1
Sequence:CCGGCTGTGACAAGAAGCTGCTTATCTCGAGATAAGCAGCTTCTTGTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-340s21c1
Sequence:CCGGTGGGAGGTACAATAAGAACATCTCGAGATGTTCTTATTGTACCTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-195s21c1
Sequence:CCGGGTTCGATATCTCAATGCCTATCTCGAGATAGGCATTGAGATATCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015918
VALIDATED
POP5 MISSION shRNA shRNA Plasmid DNA
processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-340s1c1
Sequence:CCGGTGGGAGGTACAATAAGAACATCTCGAGATGTTCTTATTGTACCTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-281s1c1
Sequence:CCGGCATCACATACTTGGAGAACAACTCGAGTTGTTCTCCAAGTATGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-195s1c1
Sequence:CCGGGTTCGATATCTCAATGCCTATCTCGAGATAGGCATTGAGATATCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015918.3-365s21c1
Sequence:CCGGGAAGTTCCTAATTCAGTACAACTCGAGTTGTACTGAATTAGGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-365s1c1
Sequence:CCGGGAAGTTCCTAATTCAGTACAACTCGAGTTGTACTGAATTAGGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-454s1c1
Sequence:CCGGCTGTGACAAGAAGCTGCTTATCTCGAGATAAGCAGCTTCTTGTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-281s21c1
Sequence:CCGGCATCACATACTTGGAGAACAACTCGAGTTGTTCTCCAAGTATGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-454s21c1
Sequence:CCGGCTGTGACAAGAAGCTGCTTATCTCGAGATAAGCAGCTTCTTGTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-340s21c1
Sequence:CCGGTGGGAGGTACAATAAGAACATCTCGAGATGTTCTTATTGTACCTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-195s21c1
Sequence:CCGGGTTCGATATCTCAATGCCTATCTCGAGATAGGCATTGAGATATCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015918
VALIDATED
POP5 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-340s1c1
Sequence:CCGGTGGGAGGTACAATAAGAACATCTCGAGATGTTCTTATTGTACCTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-281s1c1
Sequence:CCGGCATCACATACTTGGAGAACAACTCGAGTTGTTCTCCAAGTATGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-195s1c1
Sequence:CCGGGTTCGATATCTCAATGCCTATCTCGAGATAGGCATTGAGATATCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015918.3-365s21c1
Sequence:CCGGGAAGTTCCTAATTCAGTACAACTCGAGTTGTACTGAATTAGGAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-365s1c1
Sequence:CCGGGAAGTTCCTAATTCAGTACAACTCGAGTTGTACTGAATTAGGAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015918.3-454s1c1
Sequence:CCGGCTGTGACAAGAAGCTGCTTATCTCGAGATAAGCAGCTTCTTGTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-281s21c1
Sequence:CCGGCATCACATACTTGGAGAACAACTCGAGTTGTTCTCCAAGTATGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-454s21c1
Sequence:CCGGCTGTGACAAGAAGCTGCTTATCTCGAGATAAGCAGCTTCTTGTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-340s21c1
Sequence:CCGGTGGGAGGTACAATAAGAACATCTCGAGATGTTCTTATTGTACCTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015918.3-195s21c1
Sequence:CCGGGTTCGATATCTCAATGCCTATCTCGAGATAGGCATTGAGATATCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026398
VALIDATED
POP5 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-500s21c1
Sequence:CCGGTCTTCCTTTCATCACCTATTTCTCGAGAAATAGGTGATGAAAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-785s21c1
Sequence:CCGGACTTGTGGGAACAGGACATTACTCGAGTAATGTCCTGTTCCCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026398.2-850s1c1
Sequence:CCGGCCACAGTTCTCCAATGGAAATCTCGAGATTTCCATTGGAGAACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-425s21c1
Sequence:CCGGCCGATACCTCAATGCCTACACCTCGAGGTGTAGGCATTGAGGTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026398.2-849s1c1
Sequence:CCGGCCCACAGTTCTCCAATGGAAACTCGAGTTTCCATTGGAGAACTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-522s21c1
Sequence:CCGGGAGAACAAAGGCCACCGTTACCTCGAGGTAACGGTGGCCTTTGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026398
VALIDATED
POP5 MISSION shRNA shRNA Plasmid DNA
processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-500s21c1
Sequence:CCGGTCTTCCTTTCATCACCTATTTCTCGAGAAATAGGTGATGAAAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-785s21c1
Sequence:CCGGACTTGTGGGAACAGGACATTACTCGAGTAATGTCCTGTTCCCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026398.2-850s1c1
Sequence:CCGGCCACAGTTCTCCAATGGAAATCTCGAGATTTCCATTGGAGAACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-425s21c1
Sequence:CCGGCCGATACCTCAATGCCTACACCTCGAGGTGTAGGCATTGAGGTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026398.2-849s1c1
Sequence:CCGGCCCACAGTTCTCCAATGGAAACTCGAGTTTCCATTGGAGAACTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-522s21c1
Sequence:CCGGGAGAACAAAGGCCACCGTTACCTCGAGGTAACGGTGGCCTTTGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026398
VALIDATED
POP5 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-500s21c1
Sequence:CCGGTCTTCCTTTCATCACCTATTTCTCGAGAAATAGGTGATGAAAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-785s21c1
Sequence:CCGGACTTGTGGGAACAGGACATTACTCGAGTAATGTCCTGTTCCCACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026398.2-850s1c1
Sequence:CCGGCCACAGTTCTCCAATGGAAATCTCGAGATTTCCATTGGAGAACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-425s21c1
Sequence:CCGGCCGATACCTCAATGCCTACACCTCGAGGTGTAGGCATTGAGGTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026398.2-849s1c1
Sequence:CCGGCCCACAGTTCTCCAATGGAAACTCGAGTTTCCATTGGAGAACTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026398.4-522s21c1
Sequence:CCGGGAGAACAAAGGCCACCGTTACCTCGAGGTAACGGTGGCCTTTGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)