EMAIL THIS PAGE TO A FRIEND

POP7

processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)

47 Gene Product Result for
Synonyms: 0610037N12Rik RPP2 RPP20
UniProtKB ID: O75817, A4D2E0, Q9BV74
Gene ID:
Mouse(74097) processing of precursor 7, ribonuclease P family, (S. cerevisiae)
Rat(288564) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Zebrafish(100004610) processing of precursor 7, ribonuclease P family
domestic cat(101093980) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
dog(489832) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
domestic guinea pig(100713650) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
naked mole-rat(101710275) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
cow(617906) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
sheep(101102363) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Goat(100861331) processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005837 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138361 MISSION® esiRNA esiRNA human POP7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005837 Rosetta Predictions human pricing
NM_001105918 Rosetta Predictions rat pricing
NM_028753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098142 predicted 670
2 SASI_Hs01_00098143 predicted 310
3 SASI_Hs01_00098145 predicted 354
4 SASI_Hs01_00098144 predicted 438
5 SASI_Hs02_00340369 predicted 484
6 SASI_Hs01_00098146 predicted 352
7 SASI_Hs01_00098147 predicted 641
8 SASI_Hs02_00340370 predicted 481
9 SASI_Hs01_00098148 predicted 500
10 SASI_Hs01_00098149 predicted 617
11 SASI_Hs01_00098150 predicted 580
12 SASI_Hs01_00098151 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213822 predicted 478
2 SASI_Rn02_00213823 predicted 249
3 SASI_Rn02_00213824 predicted 303
4 SASI_Rn02_00213825 predicted 428
5 SASI_Rn02_00213826 predicted 297
6 SASI_Rn02_00213827 predicted 616
7 SASI_Rn02_00213828 predicted 383
8 SASI_Rn02_00213829 predicted 386
9 SASI_Rn02_00213830 predicted 485
10 SASI_Rn02_00213831 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049142 predicted 386
2 SASI_Mm02_00334334 predicted 285
3 SASI_Mm01_00049143 predicted 260
4 SASI_Mm01_00049144 predicted 391
5 SASI_Mm01_00049145 predicted 256
6 SASI_Mm01_00049146 predicted 344
7 SASI_Mm01_00049147 predicted 439
8 SASI_Mm01_00049148 predicted 522
9 SASI_Mm01_00049149 predicted 349
10 SASI_Mm01_00049150 predicted 342
11 SASI_Mm01_00049151 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028753
VALIDATED
POP7 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-642s21c1
Sequence:CCGGCGAGGTTTCTAGTGCTTCATACTCGAGTATGAAGCACTAGAAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-547s21c1
Sequence:CCGGCCATCCACATCCGAGTCTTCACTCGAGTGAAGACTCGGATGTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-219s21c1
Sequence:CCGGTACACCCTTCGGAAGCGACTTCTCGAGAAGTCGCTTCCGAAGGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-569s21c1
Sequence:CCGGGGTCACGCCCAAGTAACTGAACTCGAGTTCAGTTACTTGGGCGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028753.1-644s1c1
Sequence:CCGGCGAGGTTTCTAGTGCTTCATACTCGAGTATGAAGCACTAGAAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-356s1c1
Sequence:CCGGGCATGCACTGAAATCTACATTCTCGAGAATGTAGATTTCAGTGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-278s1c1
Sequence:CCGGGTCAACATGAAGACTGACTTTCTCGAGAAAGTCAGTCTTCATGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028753.1-265s1c1
Sequence:CCGGCAACGACATTTATGTCAACATCTCGAGATGTTGACATAAATGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-262s1c1
Sequence:CCGGGCCCAACGACATTTATGTCAACTCGAGTTGACATAAATGTCGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-354s21c1
Sequence:CCGGGCATGCACTGAAATCTACATTCTCGAGAATGTAGATTTCAGTGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028753
VALIDATED
POP7 MISSION shRNA shRNA Plasmid DNA
processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-642s21c1
Sequence:CCGGCGAGGTTTCTAGTGCTTCATACTCGAGTATGAAGCACTAGAAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-547s21c1
Sequence:CCGGCCATCCACATCCGAGTCTTCACTCGAGTGAAGACTCGGATGTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-219s21c1
Sequence:CCGGTACACCCTTCGGAAGCGACTTCTCGAGAAGTCGCTTCCGAAGGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-569s21c1
Sequence:CCGGGGTCACGCCCAAGTAACTGAACTCGAGTTCAGTTACTTGGGCGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028753.1-644s1c1
Sequence:CCGGCGAGGTTTCTAGTGCTTCATACTCGAGTATGAAGCACTAGAAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-356s1c1
Sequence:CCGGGCATGCACTGAAATCTACATTCTCGAGAATGTAGATTTCAGTGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-278s1c1
Sequence:CCGGGTCAACATGAAGACTGACTTTCTCGAGAAAGTCAGTCTTCATGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028753.1-265s1c1
Sequence:CCGGCAACGACATTTATGTCAACATCTCGAGATGTTGACATAAATGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-262s1c1
Sequence:CCGGGCCCAACGACATTTATGTCAACTCGAGTTGACATAAATGTCGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-354s21c1
Sequence:CCGGGCATGCACTGAAATCTACATTCTCGAGAATGTAGATTTCAGTGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028753
VALIDATED
POP7 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-642s21c1
Sequence:CCGGCGAGGTTTCTAGTGCTTCATACTCGAGTATGAAGCACTAGAAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-547s21c1
Sequence:CCGGCCATCCACATCCGAGTCTTCACTCGAGTGAAGACTCGGATGTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-219s21c1
Sequence:CCGGTACACCCTTCGGAAGCGACTTCTCGAGAAGTCGCTTCCGAAGGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-569s21c1
Sequence:CCGGGGTCACGCCCAAGTAACTGAACTCGAGTTCAGTTACTTGGGCGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028753.1-644s1c1
Sequence:CCGGCGAGGTTTCTAGTGCTTCATACTCGAGTATGAAGCACTAGAAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-356s1c1
Sequence:CCGGGCATGCACTGAAATCTACATTCTCGAGAATGTAGATTTCAGTGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-278s1c1
Sequence:CCGGGTCAACATGAAGACTGACTTTCTCGAGAAAGTCAGTCTTCATGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028753.1-265s1c1
Sequence:CCGGCAACGACATTTATGTCAACATCTCGAGATGTTGACATAAATGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028753.1-262s1c1
Sequence:CCGGGCCCAACGACATTTATGTCAACTCGAGTTGACATAAATGTCGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028753.2-354s21c1
Sequence:CCGGGCATGCACTGAAATCTACATTCTCGAGAATGTAGATTTCAGTGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005837
VALIDATED
POP7 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-664s21c1
Sequence:CCGGCTTCAGGGTCACACCCAAGTACTCGAGTACTTGGGTGTGACCCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-456s21c1
Sequence:CCGGCGTGCTCTGAGATCTACATTCCTCGAGGAATGTAGATCTCAGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-377s21c1
Sequence:CCGGGTCAACATGAAGACGGACTTTCTCGAGAAAGTCCGTCTTCATGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005837.2-726s21c1
Sequence:CCGGCTCTTCGCATGCTGAGTACTGCTCGAGCAGTACTCAGCATGCGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-355s21c1
Sequence:CCGGCCGGAGACCCAATGACATTTACTCGAGTAAATGTCATTGGGTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-262s1c1
Sequence:CCGGCGGAGACCCAATGACATTTATCTCGAGATAAATGTCATTGGGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-283s1c1
Sequence:CCGGGTCAACATGAAGACGGACTTTCTCGAGAAAGTCCGTCTTCATGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005837.1-219s1c1
Sequence:CCGGAGTGGAATACACCCTTAGGAACTCGAGTTCCTAAGGGTGTATTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-570s1c1
Sequence:CCGGCTTCAGGGTCACACCCAAGTACTCGAGTACTTGGGTGTGACCCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005837.1-369s1c1
Sequence:CCGGTGAGATCTACATTCACGGCTTCTCGAGAAGCCGTGAATGTAGATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005837
VALIDATED
POP7 MISSION shRNA shRNA Plasmid DNA
processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-664s21c1
Sequence:CCGGCTTCAGGGTCACACCCAAGTACTCGAGTACTTGGGTGTGACCCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-456s21c1
Sequence:CCGGCGTGCTCTGAGATCTACATTCCTCGAGGAATGTAGATCTCAGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-377s21c1
Sequence:CCGGGTCAACATGAAGACGGACTTTCTCGAGAAAGTCCGTCTTCATGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005837.2-726s21c1
Sequence:CCGGCTCTTCGCATGCTGAGTACTGCTCGAGCAGTACTCAGCATGCGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-355s21c1
Sequence:CCGGCCGGAGACCCAATGACATTTACTCGAGTAAATGTCATTGGGTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-262s1c1
Sequence:CCGGCGGAGACCCAATGACATTTATCTCGAGATAAATGTCATTGGGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-283s1c1
Sequence:CCGGGTCAACATGAAGACGGACTTTCTCGAGAAAGTCCGTCTTCATGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005837.1-219s1c1
Sequence:CCGGAGTGGAATACACCCTTAGGAACTCGAGTTCCTAAGGGTGTATTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-570s1c1
Sequence:CCGGCTTCAGGGTCACACCCAAGTACTCGAGTACTTGGGTGTGACCCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005837.1-369s1c1
Sequence:CCGGTGAGATCTACATTCACGGCTTCTCGAGAAGCCGTGAATGTAGATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005837
VALIDATED
POP7 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-664s21c1
Sequence:CCGGCTTCAGGGTCACACCCAAGTACTCGAGTACTTGGGTGTGACCCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-456s21c1
Sequence:CCGGCGTGCTCTGAGATCTACATTCCTCGAGGAATGTAGATCTCAGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-377s21c1
Sequence:CCGGGTCAACATGAAGACGGACTTTCTCGAGAAAGTCCGTCTTCATGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005837.2-726s21c1
Sequence:CCGGCTCTTCGCATGCTGAGTACTGCTCGAGCAGTACTCAGCATGCGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005837.2-355s21c1
Sequence:CCGGCCGGAGACCCAATGACATTTACTCGAGTAAATGTCATTGGGTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-262s1c1
Sequence:CCGGCGGAGACCCAATGACATTTATCTCGAGATAAATGTCATTGGGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-283s1c1
Sequence:CCGGGTCAACATGAAGACGGACTTTCTCGAGAAAGTCCGTCTTCATGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005837.1-219s1c1
Sequence:CCGGAGTGGAATACACCCTTAGGAACTCGAGTTCCTAAGGGTGTATTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005837.1-570s1c1
Sequence:CCGGCTTCAGGGTCACACCCAAGTACTCGAGTACTTGGGTGTGACCCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005837.1-369s1c1
Sequence:CCGGTGAGATCTACATTCACGGCTTCTCGAGAAGCCGTGAATGTAGATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)