EMAIL THIS PAGE TO A FRIEND

POR

P450 (cytochrome) oxidoreductase

50 Gene Product Result for
Synonyms: CPR CYPOR P450R
UniProtKB ID: P16435, Q16455, Q197M5, Q8N181, Q9H3M8, Q9UDT3
Gene ID:
Human(5447) Summary: This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]
Mouse(18984) P450 (cytochrome) oxidoreductase
Rat(29441) P450 (cytochrome) oxidoreductase
cow(532512) P450 (cytochrome) oxidoreductase
sheep(101115252) P450 (cytochrome) oxidoreductase
naked mole-rat(101712555) P450 (cytochrome) oxidoreductase
Domestic Rabbit(100301554) P450 (cytochrome) oxidoreductase
domestic guinea pig(100135602) P450 (cytochrome) oxidoreductase
fruit fly(32818) porcupine
Horse(100059789) P450 (cytochrome) oxidoreductase
domestic cat(101085768) P450 (cytochrome) oxidoreductase
dog(489816) P450 (cytochrome) oxidoreductase
chicken(417520) P450 (cytochrome) oxidoreductase
Zebrafish(568202) P450 (cytochrome) oxidoreductase
Thale Cress(830151) tubulin-folding cofactor C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000941 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000941 Rosetta Predictions human pricing
NM_031576 Rosetta Predictions rat pricing
NM_008898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216913 predicted 883
2 SASI_Hs01_00216914 predicted 1497
3 SASI_Hs01_00216915 predicted 1560
4 SASI_Hs01_00216916 predicted 826
5 SASI_Hs01_00216917 predicted 1074
6 SASI_Hs01_00216918 predicted 2192
7 SASI_Hs01_00216919 predicted 1139
8 SASI_Hs01_00216920 predicted 1509
9 SASI_Hs01_00216921 predicted 327
10 SASI_Hs01_00216922 predicted 2063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073286 predicted 1085
2 SASI_Rn01_00073287 predicted 1241
3 SASI_Rn02_00264838 predicted 541
4 SASI_Rn01_00073288 predicted 265
5 SASI_Rn01_00073289 predicted 2056
6 SASI_Rn01_00073290 predicted 530
7 SASI_Rn01_00073291 predicted 855
8 SASI_Rn01_00073292 predicted 1178
9 SASI_Rn01_00073293 predicted 1563
10 SASI_Rn02_00264839 predicted 557
11 SASI_Rn01_00073294 predicted 573
12 SASI_Rn01_00073295 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084505 predicted 2118
2 SASI_Mm01_00084506 predicted 549
3 SASI_Mm01_00084507 predicted 1077
4 SASI_Mm01_00084508 predicted 571
5 SASI_Mm01_00084509 predicted 1323
6 SASI_Mm01_00084510 predicted 994
7 SASI_Mm01_00084511 predicted 207
8 SASI_Mm01_00084512 predicted 829
9 SASI_Mm01_00084513 predicted 442
10 SASI_Mm02_00314911 predicted 1943
11 SASI_Mm01_00084514 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008898
VALIDATED
POR MISSION shRNA Bacterial Glycerol Stock
P450 (cytochrome) oxidoreductase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-1949s1c1
Sequence:CCGGGCTCGAAATATGGCCAAAGATCTCGAGATCTTTGGCCATATTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-279s1c1
Sequence:CCGGCGGGAAGGAACATTATTGTATCTCGAGATACAATAATGTTCCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-163s1c1
Sequence:CCGGCCTGACCTACTGGTTCATCTTCTCGAGAAGATGAACCAGTAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-1322s1c1
Sequence:CCGGCGGAGGCACATCCTAGCCATTCTCGAGAATGGCTAGGATGTGCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-946s1c1
Sequence:CCGGGCATCTAATGCACCTGGAATTCTCGAGAATTCCAGGTGCATTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-946s21c3
Sequence:CCGGGCATCTAATGCACCTGGAATTCTCGAGAATTCCAGGTGCATTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-1949s21c1
Sequence:CCGGGCTCGAAATATGGCCAAAGATCTCGAGATCTTTGGCCATATTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-1322s21c3
Sequence:CCGGCGGAGGCACATCCTAGCCATTCTCGAGAATGGCTAGGATGTGCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-279s21c3
Sequence:CCGGCGGGAAGGAACATTATTGTATCTCGAGATACAATAATGTTCCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-163s21c3
Sequence:CCGGCCTGACCTACTGGTTCATCTTCTCGAGAAGATGAACCAGTAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008898
VALIDATED
POR MISSION shRNA shRNA Plasmid DNA
P450 (cytochrome) oxidoreductase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-1949s1c1
Sequence:CCGGGCTCGAAATATGGCCAAAGATCTCGAGATCTTTGGCCATATTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-279s1c1
Sequence:CCGGCGGGAAGGAACATTATTGTATCTCGAGATACAATAATGTTCCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-163s1c1
Sequence:CCGGCCTGACCTACTGGTTCATCTTCTCGAGAAGATGAACCAGTAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-1322s1c1
Sequence:CCGGCGGAGGCACATCCTAGCCATTCTCGAGAATGGCTAGGATGTGCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-946s1c1
Sequence:CCGGGCATCTAATGCACCTGGAATTCTCGAGAATTCCAGGTGCATTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-946s21c3
Sequence:CCGGGCATCTAATGCACCTGGAATTCTCGAGAATTCCAGGTGCATTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-1949s21c1
Sequence:CCGGGCTCGAAATATGGCCAAAGATCTCGAGATCTTTGGCCATATTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-1322s21c3
Sequence:CCGGCGGAGGCACATCCTAGCCATTCTCGAGAATGGCTAGGATGTGCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-279s21c3
Sequence:CCGGCGGGAAGGAACATTATTGTATCTCGAGATACAATAATGTTCCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-163s21c3
Sequence:CCGGCCTGACCTACTGGTTCATCTTCTCGAGAAGATGAACCAGTAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008898
VALIDATED
POR MISSION shRNA Lentiviral Transduction Particles
P450 (cytochrome) oxidoreductase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-1949s1c1
Sequence:CCGGGCTCGAAATATGGCCAAAGATCTCGAGATCTTTGGCCATATTTCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-279s1c1
Sequence:CCGGCGGGAAGGAACATTATTGTATCTCGAGATACAATAATGTTCCTTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-163s1c1
Sequence:CCGGCCTGACCTACTGGTTCATCTTCTCGAGAAGATGAACCAGTAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-1322s1c1
Sequence:CCGGCGGAGGCACATCCTAGCCATTCTCGAGAATGGCTAGGATGTGCCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008898.1-946s1c1
Sequence:CCGGGCATCTAATGCACCTGGAATTCTCGAGAATTCCAGGTGCATTAGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-946s21c3
Sequence:CCGGGCATCTAATGCACCTGGAATTCTCGAGAATTCCAGGTGCATTAGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-1949s21c1
Sequence:CCGGGCTCGAAATATGGCCAAAGATCTCGAGATCTTTGGCCATATTTCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-1322s21c3
Sequence:CCGGCGGAGGCACATCCTAGCCATTCTCGAGAATGGCTAGGATGTGCCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-279s21c3
Sequence:CCGGCGGGAAGGAACATTATTGTATCTCGAGATACAATAATGTTCCTTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008898.1-163s21c3
Sequence:CCGGCCTGACCTACTGGTTCATCTTCTCGAGAAGATGAACCAGTAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000941
VALIDATED
POR MISSION shRNA Bacterial Glycerol Stock
P450 (cytochrome) oxidoreductase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000941.1-1086s1c1
Sequence:CCGGGTCCAACAAGAAGCACCCATTCTCGAGAATGGGTGCTTCTTGTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-71s1c1
Sequence:CCGGTGGCCGAAGAAGTATCTCTTTCTCGAGAAAGAGATACTTCTTCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000941.1-816s1c1
Sequence:CCGGCCGGCTGAAGAGCTACGAGAACTCGAGTTCTCGTAGCTCTTCAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-1867s1c1
Sequence:CCGGCACCTGTGGAAGTTGATCGAACTCGAGTTCGATCAACTTCCACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-135s1c1
Sequence:CCGGCCTAACCTACTGGTTCCTCTTCTCGAGAAGAGGAACCAGTAGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000941
VALIDATED
POR MISSION shRNA shRNA Plasmid DNA
P450 (cytochrome) oxidoreductase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000941.1-1086s1c1
Sequence:CCGGGTCCAACAAGAAGCACCCATTCTCGAGAATGGGTGCTTCTTGTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-71s1c1
Sequence:CCGGTGGCCGAAGAAGTATCTCTTTCTCGAGAAAGAGATACTTCTTCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000941.1-816s1c1
Sequence:CCGGCCGGCTGAAGAGCTACGAGAACTCGAGTTCTCGTAGCTCTTCAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-1867s1c1
Sequence:CCGGCACCTGTGGAAGTTGATCGAACTCGAGTTCGATCAACTTCCACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-135s1c1
Sequence:CCGGCCTAACCTACTGGTTCCTCTTCTCGAGAAGAGGAACCAGTAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000941
VALIDATED
POR MISSION shRNA Lentiviral Transduction Particles
P450 (cytochrome) oxidoreductase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000941.1-1086s1c1
Sequence:CCGGGTCCAACAAGAAGCACCCATTCTCGAGAATGGGTGCTTCTTGTTGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-71s1c1
Sequence:CCGGTGGCCGAAGAAGTATCTCTTTCTCGAGAAAGAGATACTTCTTCGGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000941.1-816s1c1
Sequence:CCGGCCGGCTGAAGAGCTACGAGAACTCGAGTTCTCGTAGCTCTTCAGCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-1867s1c1
Sequence:CCGGCACCTGTGGAAGTTGATCGAACTCGAGTTCGATCAACTTCCACAGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000941.1-135s1c1
Sequence:CCGGCCTAACCTACTGGTTCCTCTTCTCGAGAAGAGGAACCAGTAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)