EMAIL THIS PAGE TO A FRIEND

PORCN

porcupine homolog (Drosophila)

147 Gene Product Result for
Synonyms: DHOF FODH MG61 PORC PPN
Gene ID:
Human(64840) Summary: This gene belongs to the evolutionarily conserved porcupine (Porc) gene family. Genes of the Porc family encode endoplasmic reticulum proteins with multiple transmembrane domains. Porcupine proteins are involved in the processing of Wnt (wingless and int homologue) proteins. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(53627) porcupine homolog (Drosophila)
Rat(317368) porcupine homolog (Drosophila)
Zebrafish(100006275) porcupine homolog (Drosophila)
Horse(100051598) porcupine homolog (Drosophila)
domestic cat(101093667) porcupine homolog (Drosophila)
dog(480903) porcupine homolog (Drosophila)
chicken(751620) porcupine
domestic guinea pig(100729593) porcupine homolog (Drosophila)
Domestic Rabbit(100342483) porcupine homolog (Drosophila)
naked mole-rat(101700667) porcupine homolog (Drosophila)
cow(540373) porcupine homolog (Drosophila)
sheep(101112290) porcupine homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022825 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022825 Rosetta Predictions human pricing
NM_203473 Rosetta Predictions human pricing
NM_203474 Rosetta Predictions human pricing
NM_203475 Rosetta Predictions human pricing
NM_203476 Rosetta Predictions human pricing
XM_001063037 Rosetta Predictions rat pricing
XM_228781 Rosetta Predictions rat pricing
NM_016913 Rosetta Predictions mouse pricing
NM_023638 Rosetta Predictions mouse pricing
NM_145907 Rosetta Predictions mouse pricing
NM_145908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118098 predicted 1042
2 SASI_Hs01_00118099 predicted 604
3 SASI_Hs01_00118100 predicted 1312
4 SASI_Hs01_00118101 predicted 616
5 SASI_Hs01_00118102 predicted 1046
6 SASI_Hs01_00118103 predicted 1137
7 SASI_Hs01_00118104 predicted 1138
8 SASI_Hs01_00118105 predicted 1048
9 SASI_Hs01_00118106 predicted 1047
10 SASI_Hs01_00118107 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057373 predicted 1059
2 SASI_Hs01_00057374 predicted 605
3 SASI_Hs01_00057375 predicted 1326
4 SASI_Hs01_00057376 predicted 608
5 SASI_Hs01_00057377 predicted 1063
6 SASI_Hs01_00057378 predicted 1154
7 SASI_Hs01_00057379 predicted 1150
8 SASI_Hs01_00057380 predicted 1069
9 SASI_Hs01_00057381 predicted 1070
10 SASI_Hs01_00057382 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202964 predicted 933
2 SASI_Hs01_00202965 predicted 482
3 SASI_Hs01_00202966 predicted 1206
4 SASI_Hs01_00202967 predicted 491
5 SASI_Hs01_00202968 predicted 937
6 SASI_Hs01_00202969 predicted 1023
7 SASI_Hs01_00202970 predicted 1030
8 SASI_Hs01_00202971 predicted 945
9 SASI_Hs01_00202972 predicted 945
10 SASI_Hs01_00202973 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142791 predicted 951
2 SASI_Hs01_00142792 predicted 491
3 SASI_Hs01_00142793 predicted 1217
4 SASI_Hs01_00142794 predicted 487
5 SASI_Hs01_00142795 predicted 958
6 SASI_Hs01_00142796 predicted 1042
7 SASI_Hs01_00142797 predicted 1049
8 SASI_Hs01_00142798 predicted 962
9 SASI_Hs01_00142799 predicted 965
10 SASI_Hs01_00142800 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065550 predicted 970
2 SASI_Hs01_00065551 predicted 541
3 SASI_Hs01_00065552 predicted 1238
4 SASI_Hs01_00065553 predicted 541
5 SASI_Hs01_00065554 predicted 969
6 SASI_Hs01_00065555 predicted 1067
7 SASI_Hs01_00065556 predicted 1061
8 SASI_Hs01_00065557 predicted 977
9 SASI_Hs01_00065558 predicted 980
10 SASI_Hs01_00065559 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305532 predicted 1138
2 SASI_Rn02_00305533 predicted 412
3 SASI_Rn02_00305534 predicted 1046
4 SASI_Rn02_00305535 predicted 1528
5 SASI_Rn02_00305536 predicted 1165
6 SASI_Rn02_00305537 predicted 230
7 SASI_Rn02_00305538 predicted 1166
8 SASI_Rn02_00305539 predicted 1490
9 SASI_Rn02_00305540 predicted 1206
10 SASI_Rn02_00305541 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385507 predicted 1609
2 SASI_Rn02_00385508 predicted 1531
3 SASI_Rn02_00385509 predicted 225
4 SASI_Rn02_00385510 predicted 1488
5 SASI_Rn02_00385511 predicted 1201
6 SASI_Rn02_00385512 predicted 1532
7 SASI_Rn02_00385513 predicted 1457
8 SASI_Rn02_00385514 predicted 1284
9 SASI_Rn02_00385515 predicted 1462
10 SASI_Rn02_00385516 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056395 predicted 1517
2 SASI_Mm01_00056396 predicted 215
3 SASI_Mm01_00056397 predicted 1272
4 SASI_Mm01_00056398 predicted 1501
5 SASI_Mm01_00056399 predicted 1505
6 SASI_Mm01_00056400 predicted 1248
7 SASI_Mm01_00056402 predicted 1494
8 SASI_Mm01_00056403 predicted 340
9 SASI_Mm01_00056404 predicted 1347
10 SASI_Mm02_00323772 predicted 1430
11 SASI_Mm01_00056401 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149602 predicted 1553
2 SASI_Mm01_00149603 predicted 209
3 SASI_Mm01_00149604 predicted 1305
4 SASI_Mm01_00149605 predicted 1536
5 SASI_Mm01_00149606 predicted 1541
6 SASI_Mm01_00149607 predicted 1281
7 SASI_Mm01_00149609 predicted 1531
8 SASI_Mm01_00149610 predicted 348
9 SASI_Mm01_00149611 predicted 1375
10 SASI_Mm02_00327255 predicted 1466
11 SASI_Mm01_00149608 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109406 predicted 1538
2 SASI_Mm01_00109407 predicted 212
3 SASI_Mm01_00109408 predicted 1284
4 SASI_Mm01_00109409 predicted 1519
5 SASI_Mm01_00109410 predicted 1522
6 SASI_Mm01_00109411 predicted 1262
7 SASI_Mm01_00109413 predicted 1508
8 SASI_Mm01_00109414 predicted 339
9 SASI_Mm01_00109415 predicted 1358
10 SASI_Mm02_00341361 predicted 1450
11 SASI_Mm01_00109412 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087197 predicted 1534
2 SASI_Mm01_00087198 predicted 213
3 SASI_Mm01_00087199 predicted 1292
4 SASI_Mm01_00087200 predicted 1525
5 SASI_Mm01_00087201 predicted 1528
6 SASI_Mm01_00087202 predicted 1264
7 SASI_Mm01_00087204 predicted 1513
8 SASI_Mm01_00087205 predicted 345
9 SASI_Mm01_00087206 predicted 1361
10 SASI_Mm02_00341362 predicted 1451
11 SASI_Mm01_00087203 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022825
VALIDATED
PORCN MISSION shRNA Bacterial Glycerol Stock
porcupine homolog (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-874s1c1
Sequence:CCGGCCTTCCACTTCAGCAACTATTCTCGAGAATAGTTGCTGAAGTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-875s1c1
Sequence:CCGGCTTCCACTTCAGCAACTATTTCTCGAGAAATAGTTGCTGAAGTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022825.2-1371s1c1
Sequence:CCGGCTGTTTGATGTCGATGTGGATCTCGAGATCCACATCGACATCAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-1484s1c1
Sequence:CCGGCTGGATCTTCTACCGTCTCATCTCGAGATGAGACGGTAGAAGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022825.2-1310s1c1
Sequence:CCGGGCGAGCCTTAAACTTGCTCTTCTCGAGAAGAGCAAGTTTAAGGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-412s21c1
Sequence:CCGGTGCTGTTCCTCTGCCGACATTCTCGAGAATGTCGGCAGAGGAACAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-620s21c1
Sequence:CCGGGTTCATGGGCTACCTCTACTTCTCGAGAAGTAGAGGTAGCCCATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-1242s21c1
Sequence:CCGGAGTGCCTGTGTCTTGTCAAAGCTCGAGCTTTGACAAGACACAGGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022825.2-1523s21c1
Sequence:CCGGGGACCCTCATAACCCTCTTAACTCGAGTTAAGAGGGTTATGAGGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-454s21c1
Sequence:CCGGTATCCGTCACCATCCTCATCTCTCGAGAGATGAGGATGGTGACGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-505s21c1
Sequence:CCGGACACCGTGACATGGCACAAGACTCGAGTCTTGTGCCATGTCACGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022825
VALIDATED
PORCN MISSION shRNA shRNA Plasmid DNA
porcupine homolog (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-874s1c1
Sequence:CCGGCCTTCCACTTCAGCAACTATTCTCGAGAATAGTTGCTGAAGTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-875s1c1
Sequence:CCGGCTTCCACTTCAGCAACTATTTCTCGAGAAATAGTTGCTGAAGTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022825.2-1371s1c1
Sequence:CCGGCTGTTTGATGTCGATGTGGATCTCGAGATCCACATCGACATCAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-1484s1c1
Sequence:CCGGCTGGATCTTCTACCGTCTCATCTCGAGATGAGACGGTAGAAGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022825.2-1310s1c1
Sequence:CCGGGCGAGCCTTAAACTTGCTCTTCTCGAGAAGAGCAAGTTTAAGGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-412s21c1
Sequence:CCGGTGCTGTTCCTCTGCCGACATTCTCGAGAATGTCGGCAGAGGAACAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-620s21c1
Sequence:CCGGGTTCATGGGCTACCTCTACTTCTCGAGAAGTAGAGGTAGCCCATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-1242s21c1
Sequence:CCGGAGTGCCTGTGTCTTGTCAAAGCTCGAGCTTTGACAAGACACAGGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022825.2-1523s21c1
Sequence:CCGGGGACCCTCATAACCCTCTTAACTCGAGTTAAGAGGGTTATGAGGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-454s21c1
Sequence:CCGGTATCCGTCACCATCCTCATCTCTCGAGAGATGAGGATGGTGACGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-505s21c1
Sequence:CCGGACACCGTGACATGGCACAAGACTCGAGTCTTGTGCCATGTCACGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022825
VALIDATED
PORCN MISSION shRNA Lentiviral Transduction Particles
porcupine homolog (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-874s1c1
Sequence:CCGGCCTTCCACTTCAGCAACTATTCTCGAGAATAGTTGCTGAAGTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-875s1c1
Sequence:CCGGCTTCCACTTCAGCAACTATTTCTCGAGAAATAGTTGCTGAAGTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022825.2-1371s1c1
Sequence:CCGGCTGTTTGATGTCGATGTGGATCTCGAGATCCACATCGACATCAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022825.2-1484s1c1
Sequence:CCGGCTGGATCTTCTACCGTCTCATCTCGAGATGAGACGGTAGAAGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022825.2-1310s1c1
Sequence:CCGGGCGAGCCTTAAACTTGCTCTTCTCGAGAAGAGCAAGTTTAAGGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-412s21c1
Sequence:CCGGTGCTGTTCCTCTGCCGACATTCTCGAGAATGTCGGCAGAGGAACAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-620s21c1
Sequence:CCGGGTTCATGGGCTACCTCTACTTCTCGAGAAGTAGAGGTAGCCCATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-1242s21c1
Sequence:CCGGAGTGCCTGTGTCTTGTCAAAGCTCGAGCTTTGACAAGACACAGGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022825.2-1523s21c1
Sequence:CCGGGGACCCTCATAACCCTCTTAACTCGAGTTAAGAGGGTTATGAGGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-454s21c1
Sequence:CCGGTATCCGTCACCATCCTCATCTCTCGAGAGATGAGGATGGTGACGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022825.2-505s21c1
Sequence:CCGGACACCGTGACATGGCACAAGACTCGAGTCTTGTGCCATGTCACGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016913
PORCN MISSION shRNA Bacterial Glycerol Stock
porcupine homolog (Drosophila)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016913.1-1671s1c1
Sequence:CCGGCAACTTTCTATGCCTGTCAATCTCGAGATTGACAGGCATAGAAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1062s1c1
Sequence:CCGGCCCATGTCTTATTGGTTAAATCTCGAGATTTAACCAATAAGACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-263s1c1
Sequence:CCGGGCTGCTTCTTACCATCTGCTTCTCGAGAAGCAGATGGTAAGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1326s1c1
Sequence:CCGGCGAGCCTTAAACTTGCTCTTTCTCGAGAAAGAGCAAGTTTAAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1061s1c1
Sequence:CCGGGCCCATGTCTTATTGGTTAAACTCGAGTTTAACCAATAAGACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-1057s21c1
Sequence:CCGGTGCCCATGTCTTATTGGTTAACTCGAGTTAACCAATAAGACATGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-652s21c1
Sequence:CCGGTTGTGGGCACCATCGTCTTTGCTCGAGCAAAGACGATGGTGCCCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-991s21c1
Sequence:CCGGCAGTCTCTAGACCGTTGAATGCTCGAGCATTCAACGGTCTAGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1512s21c1
Sequence:CCGGGGATCTTCTACCGTCTCATAGCTCGAGCTATGAGACGGTAGAAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-900s21c1
Sequence:CCGGCCTTCCACTTCAGCAACTATTCTCGAGAATAGTTGCTGAAGTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1268s21c1
Sequence:CCGGAGTGCCTGCATCTTGTCAAAGCTCGAGCTTTGACAAGATGCAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1074s21c1
Sequence:CCGGCCATGTCTTATTGGTTAAATACTCGAGTATTTAACCAATAAGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016913.3-1607s21c1
Sequence:CCGGAGACCCTTTCTCTACTCCTTTCTCGAGAAAGGAGTAGAGAAAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016913.2-1659s21c1
Sequence:CCGGGAACACACACAACTTTCTATGCTCGAGCATAGAAAGTTGTGTGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-887s21c1
Sequence:CCGGCTTCCACTTCAGCAACTATTTCTCGAGAAATAGTTGCTGAAGTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016913
PORCN MISSION shRNA shRNA Plasmid DNA
porcupine homolog (Drosophila)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016913.1-1671s1c1
Sequence:CCGGCAACTTTCTATGCCTGTCAATCTCGAGATTGACAGGCATAGAAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1062s1c1
Sequence:CCGGCCCATGTCTTATTGGTTAAATCTCGAGATTTAACCAATAAGACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-263s1c1
Sequence:CCGGGCTGCTTCTTACCATCTGCTTCTCGAGAAGCAGATGGTAAGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1326s1c1
Sequence:CCGGCGAGCCTTAAACTTGCTCTTTCTCGAGAAAGAGCAAGTTTAAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1061s1c1
Sequence:CCGGGCCCATGTCTTATTGGTTAAACTCGAGTTTAACCAATAAGACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-1057s21c1
Sequence:CCGGTGCCCATGTCTTATTGGTTAACTCGAGTTAACCAATAAGACATGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-652s21c1
Sequence:CCGGTTGTGGGCACCATCGTCTTTGCTCGAGCAAAGACGATGGTGCCCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-991s21c1
Sequence:CCGGCAGTCTCTAGACCGTTGAATGCTCGAGCATTCAACGGTCTAGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1512s21c1
Sequence:CCGGGGATCTTCTACCGTCTCATAGCTCGAGCTATGAGACGGTAGAAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-900s21c1
Sequence:CCGGCCTTCCACTTCAGCAACTATTCTCGAGAATAGTTGCTGAAGTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1268s21c1
Sequence:CCGGAGTGCCTGCATCTTGTCAAAGCTCGAGCTTTGACAAGATGCAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1074s21c1
Sequence:CCGGCCATGTCTTATTGGTTAAATACTCGAGTATTTAACCAATAAGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016913.3-1607s21c1
Sequence:CCGGAGACCCTTTCTCTACTCCTTTCTCGAGAAAGGAGTAGAGAAAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016913.2-1659s21c1
Sequence:CCGGGAACACACACAACTTTCTATGCTCGAGCATAGAAAGTTGTGTGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-887s21c1
Sequence:CCGGCTTCCACTTCAGCAACTATTTCTCGAGAAATAGTTGCTGAAGTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016913
PORCN MISSION shRNA Lentiviral Transduction Particles
porcupine homolog (Drosophila)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016913.1-1671s1c1
Sequence:CCGGCAACTTTCTATGCCTGTCAATCTCGAGATTGACAGGCATAGAAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1062s1c1
Sequence:CCGGCCCATGTCTTATTGGTTAAATCTCGAGATTTAACCAATAAGACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-263s1c1
Sequence:CCGGGCTGCTTCTTACCATCTGCTTCTCGAGAAGCAGATGGTAAGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1326s1c1
Sequence:CCGGCGAGCCTTAAACTTGCTCTTTCTCGAGAAAGAGCAAGTTTAAGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016913.1-1061s1c1
Sequence:CCGGGCCCATGTCTTATTGGTTAAACTCGAGTTTAACCAATAAGACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-1057s21c1
Sequence:CCGGTGCCCATGTCTTATTGGTTAACTCGAGTTAACCAATAAGACATGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-652s21c1
Sequence:CCGGTTGTGGGCACCATCGTCTTTGCTCGAGCAAAGACGATGGTGCCCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-991s21c1
Sequence:CCGGCAGTCTCTAGACCGTTGAATGCTCGAGCATTCAACGGTCTAGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1512s21c1
Sequence:CCGGGGATCTTCTACCGTCTCATAGCTCGAGCTATGAGACGGTAGAAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-900s21c1
Sequence:CCGGCCTTCCACTTCAGCAACTATTCTCGAGAATAGTTGCTGAAGTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1268s21c1
Sequence:CCGGAGTGCCTGCATCTTGTCAAAGCTCGAGCTTTGACAAGATGCAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.3-1074s21c1
Sequence:CCGGCCATGTCTTATTGGTTAAATACTCGAGTATTTAACCAATAAGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016913.3-1607s21c1
Sequence:CCGGAGACCCTTTCTCTACTCCTTTCTCGAGAAAGGAGTAGAGAAAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016913.2-1659s21c1
Sequence:CCGGGAACACACACAACTTTCTATGCTCGAGCATAGAAAGTTGTGTGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016913.2-887s21c1
Sequence:CCGGCTTCCACTTCAGCAACTATTTCTCGAGAAATAGTTGCTGAAGTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)