EMAIL THIS PAGE TO A FRIEND

POSTN

periostin, osteoblast specific factor

93 Gene Product Result for
Synonyms: OSF-2 OSF2 PDLPOSTN PN RP11-412K4.1 periostin
UniProtKB ID: Q15063, Q15064, Q29XZ0, Q3KPJ5, Q5VSY5, Q8IZF9
Gene ID:
Mouse(50706) periostin, osteoblast specific factor
Rat(361945) periostin, osteoblast specific factor
chicken(395429) periostin, osteoblast specific factor
dog(477298) periostin, osteoblast specific factor
domestic cat(101088807) periostin, osteoblast specific factor
Horse(100062608) periostin, osteoblast specific factor
naked mole-rat(101709648) periostin, osteoblast specific factor
domestic guinea pig(100718711) periostin, osteoblast specific factor
cow(281960) periostin, osteoblast specific factor
sheep(101103329) periostin, osteoblast specific factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006475 Rosetta Predictions human pricing
NM_001108550 Rosetta Predictions rat pricing
NM_015784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215117 predicted 1846
2 SASI_Hs02_00341652 predicted 2176
3 SASI_Hs01_00215119 predicted 1165
4 SASI_Hs01_00215122 predicted 882
5 SASI_Hs01_00215123 predicted 398
6 SASI_Hs02_00341653 predicted 1840
7 SASI_Hs02_00341654 predicted 1004
8 SASI_Hs02_00341655 predicted 678
9 SASI_Hs01_00215126 predicted 901
10 SASI_Hs02_00341656 predicted 616
11 SASI_Hs01_00215118 predicted 664
12 SASI_Hs01_00215120 predicted 561
13 SASI_Hs01_00215121 predicted 1863
14 SASI_Hs01_00215124 predicted 943
15 SASI_Hs01_00215125 predicted 2273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239749 predicted 1188
2 SASI_Rn02_00239750 predicted 1939
3 SASI_Rn02_00239751 predicted 1845
4 SASI_Rn02_00239752 predicted 672
5 SASI_Rn02_00239753 predicted 841
6 SASI_Rn02_00239754 predicted 2456
7 SASI_Rn02_00239755 predicted 1730
8 SASI_Rn02_00239756 predicted 1503
9 SASI_Rn02_00239757 predicted 526
10 SASI_Rn02_00239758 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149990 predicted 1906
2 SASI_Mm01_00149991 predicted 1906
3 SASI_Mm01_00149992 predicted 1942
4 SASI_Mm02_00323146 predicted 1123
5 SASI_Mm01_00149993 predicted 531
6 SASI_Mm01_00149994 predicted 1380
7 SASI_Mm01_00149995 predicted 1029
8 SASI_Mm01_00149996 predicted 498
9 SASI_Mm01_00149997 predicted 669
10 SASI_Mm01_00149998 predicted 416
11 SASI_Mm01_00149999 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006475
VALIDATED
POSTN MISSION shRNA Bacterial Glycerol Stock
periostin, osteoblast specific factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-2288s21c1
Sequence:CCGGATCCATGGAGAGCCAATTATTCTCGAGAATAATTGGCTCTCCATGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-1013s1c1
Sequence:CCGGCGGTGACAGTATAACAGTAAACTCGAGTTTACTGTTATACTGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006475.2-2890s21c1
Sequence:CCGGGGCTAACTTTGGAATCCATTACTCGAGTAATGGATTCCAAAGTTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-2878s1c1
Sequence:CCGGCGAGCCTTGTATGTATGTTATCTCGAGATAACATACATACAAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-185s1c1
Sequence:CCGGCACTTGTAAGAACTGGTATAACTCGAGTTATACCAGTTCTTACAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006475.1-1494s1c1
Sequence:CCGGGCAGAGAAATCCCTCCATGAACTCGAGTTCATGGAGGGATTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006475.1-252s1c1
Sequence:CCGGCCTGGTTATATGAGAATGGAACTCGAGTTCCATTCTCATATAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-157s21c1
Sequence:CCGGGCTTATTGTTAACCCTATAAACTCGAGTTTATAGGGTTAACAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-2364s21c1
Sequence:CCCGCACGAGAAGAACGAATCATTACTCGAGTAATGATTCGTTCTTCTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-1272s21c1
Sequence:CCGGCGGATCTTGTGGCCCAATTAGCTCGAGCTAATTGGGCCACAAGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006475
VALIDATED
POSTN MISSION shRNA shRNA Plasmid DNA
periostin, osteoblast specific factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-2288s21c1
Sequence:CCGGATCCATGGAGAGCCAATTATTCTCGAGAATAATTGGCTCTCCATGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-1013s1c1
Sequence:CCGGCGGTGACAGTATAACAGTAAACTCGAGTTTACTGTTATACTGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006475.2-2890s21c1
Sequence:CCGGGGCTAACTTTGGAATCCATTACTCGAGTAATGGATTCCAAAGTTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-2878s1c1
Sequence:CCGGCGAGCCTTGTATGTATGTTATCTCGAGATAACATACATACAAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-185s1c1
Sequence:CCGGCACTTGTAAGAACTGGTATAACTCGAGTTATACCAGTTCTTACAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006475.1-1494s1c1
Sequence:CCGGGCAGAGAAATCCCTCCATGAACTCGAGTTCATGGAGGGATTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006475.1-252s1c1
Sequence:CCGGCCTGGTTATATGAGAATGGAACTCGAGTTCCATTCTCATATAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-157s21c1
Sequence:CCGGGCTTATTGTTAACCCTATAAACTCGAGTTTATAGGGTTAACAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-2364s21c1
Sequence:CCCGCACGAGAAGAACGAATCATTACTCGAGTAATGATTCGTTCTTCTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-1272s21c1
Sequence:CCGGCGGATCTTGTGGCCCAATTAGCTCGAGCTAATTGGGCCACAAGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006475
VALIDATED
POSTN MISSION shRNA Lentiviral Transduction Particles
periostin, osteoblast specific factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-2288s21c1
Sequence:CCGGATCCATGGAGAGCCAATTATTCTCGAGAATAATTGGCTCTCCATGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-1013s1c1
Sequence:CCGGCGGTGACAGTATAACAGTAAACTCGAGTTTACTGTTATACTGTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006475.2-2890s21c1
Sequence:CCGGGGCTAACTTTGGAATCCATTACTCGAGTAATGGATTCCAAAGTTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-2878s1c1
Sequence:CCGGCGAGCCTTGTATGTATGTTATCTCGAGATAACATACATACAAGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006475.1-185s1c1
Sequence:CCGGCACTTGTAAGAACTGGTATAACTCGAGTTATACCAGTTCTTACAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006475.1-1494s1c1
Sequence:CCGGGCAGAGAAATCCCTCCATGAACTCGAGTTCATGGAGGGATTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006475.1-252s1c1
Sequence:CCGGCCTGGTTATATGAGAATGGAACTCGAGTTCCATTCTCATATAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-157s21c1
Sequence:CCGGGCTTATTGTTAACCCTATAAACTCGAGTTTATAGGGTTAACAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-2364s21c1
Sequence:CCCGCACGAGAAGAACGAATCATTACTCGAGTAATGATTCGTTCTTCTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006475.2-1272s21c1
Sequence:CCGGCGGATCTTGTGGCCCAATTAGCTCGAGCTAATTGGGCCACAAGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015784
POSTN MISSION shRNA Bacterial Glycerol Stock
periostin, osteoblast specific factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1474s1c1
Sequence:CCGGGCCATTCACATATTCCGAGAACTCGAGTTCTCGGAATATGTGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-525s1c1
Sequence:CCGGCCACATGGTTAATAAGAGAATCTCGAGATTCTCTTATTAACCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1222s1c1
Sequence:CCGGGATGGAGAGTACACCTTATTACTCGAGTAATAAGGTGTACTCTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1761s1c1
Sequence:CCGGCGGAGTCACTAATATCCTGAACTCGAGTTCAGGATATTAGTGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015784.1-2765s1c1
Sequence:CCGGGCTAAGTCTTTGCACAGTAAACTCGAGTTTACTGTGCAAAGACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015784
POSTN MISSION shRNA shRNA Plasmid DNA
periostin, osteoblast specific factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1474s1c1
Sequence:CCGGGCCATTCACATATTCCGAGAACTCGAGTTCTCGGAATATGTGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-525s1c1
Sequence:CCGGCCACATGGTTAATAAGAGAATCTCGAGATTCTCTTATTAACCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1222s1c1
Sequence:CCGGGATGGAGAGTACACCTTATTACTCGAGTAATAAGGTGTACTCTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1761s1c1
Sequence:CCGGCGGAGTCACTAATATCCTGAACTCGAGTTCAGGATATTAGTGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015784.1-2765s1c1
Sequence:CCGGGCTAAGTCTTTGCACAGTAAACTCGAGTTTACTGTGCAAAGACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015784
POSTN MISSION shRNA Lentiviral Transduction Particles
periostin, osteoblast specific factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1474s1c1
Sequence:CCGGGCCATTCACATATTCCGAGAACTCGAGTTCTCGGAATATGTGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-525s1c1
Sequence:CCGGCCACATGGTTAATAAGAGAATCTCGAGATTCTCTTATTAACCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1222s1c1
Sequence:CCGGGATGGAGAGTACACCTTATTACTCGAGTAATAAGGTGTACTCTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015784.1-1761s1c1
Sequence:CCGGCGGAGTCACTAATATCCTGAACTCGAGTTCAGGATATTAGTGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015784.1-2765s1c1
Sequence:CCGGGCTAAGTCTTTGCACAGTAAACTCGAGTTTACTGTGCAAAGACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)