EMAIL THIS PAGE TO A FRIEND

POTEE

POTE ankyrin domain family, member E

12 Gene Product Result for
Synonyms: A26C1 A26C1A CT104.2 POTE-2 POTE2 POTE2gamma
Species: Human POTEE(445582)
UniProtKB ID: Q6S8J3, Q6S8J4, Q6S8J5, Q6S8J8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004054 Rosetta Predictions human pricing
NM_001005359 Rosetta Predictions human pricing
NM_001005364 Rosetta Predictions human pricing
NM_001083538 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073581 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113667 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099270 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316957 predicted 1308
2 SASI_Hs02_00316958 predicted 1449
3 SASI_Hs02_00316959 predicted 1433
4 SASI_Hs02_00316960 predicted 1450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004054
POTEE MISSION shRNA Bacterial Glycerol Stock
POTE ankyrin domain family, member E
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-826s1c1
Sequence:CCGGGCTCTTATATGGTGCTGATATCTCGAGATATCAGCACCATATAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004054.2-1624s1c1
Sequence:CCGGGCAATGGTGATGATGGATTAACTCGAGTTAATCCATCATCACCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-1079s1c1
Sequence:CCGGGAGTATGCTGTTTCTAGTCATCTCGAGATGACTAGAAACAGCATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-1114s1c1
Sequence:CCGGCCAGTTACTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-202s1c1
Sequence:CCGGCGACTCTGCTATGAAGACACTCTCGAGAGTGTCTTCATAGCAGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-677s1c1
Sequence:CCGGGCTCTGATAAAGGCCGTACAACTCGAGTTGTACGGCCTTTATCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-214s1c1
Sequence:CCGGGAAGACACTCAGGAGCAAGATCTCGAGATCTTGCTCCTGAGTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004054.2-1408s1c1
Sequence:CCGGGCAACCCAGAACAAGACTTAACTCGAGTTAAGTCTTGTTCTGGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-716s1c1
Sequence:CCGGGCGTTAATGTTGCTGGAACATCTCGAGATGTTCCAGCAACATTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-815s1c1
Sequence:CCGGGCCAAAGCACTGCTCTTATATCTCGAGATATAAGAGCAGTGCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-548s1c1
Sequence:CCGGGTGAACAAGAAGGACAAGCAACTCGAGTTGCTTGTCCTTCTTGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004054
POTEE MISSION shRNA shRNA Plasmid DNA
POTE ankyrin domain family, member E
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-826s1c1
Sequence:CCGGGCTCTTATATGGTGCTGATATCTCGAGATATCAGCACCATATAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004054.2-1624s1c1
Sequence:CCGGGCAATGGTGATGATGGATTAACTCGAGTTAATCCATCATCACCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-1079s1c1
Sequence:CCGGGAGTATGCTGTTTCTAGTCATCTCGAGATGACTAGAAACAGCATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-1114s1c1
Sequence:CCGGCCAGTTACTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-202s1c1
Sequence:CCGGCGACTCTGCTATGAAGACACTCTCGAGAGTGTCTTCATAGCAGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-677s1c1
Sequence:CCGGGCTCTGATAAAGGCCGTACAACTCGAGTTGTACGGCCTTTATCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-214s1c1
Sequence:CCGGGAAGACACTCAGGAGCAAGATCTCGAGATCTTGCTCCTGAGTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004054.2-1408s1c1
Sequence:CCGGGCAACCCAGAACAAGACTTAACTCGAGTTAAGTCTTGTTCTGGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-716s1c1
Sequence:CCGGGCGTTAATGTTGCTGGAACATCTCGAGATGTTCCAGCAACATTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-815s1c1
Sequence:CCGGGCCAAAGCACTGCTCTTATATCTCGAGATATAAGAGCAGTGCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-548s1c1
Sequence:CCGGGTGAACAAGAAGGACAAGCAACTCGAGTTGCTTGTCCTTCTTGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004054
POTEE MISSION shRNA Lentiviral Transduction Particles
POTE ankyrin domain family, member E
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-826s1c1
Sequence:CCGGGCTCTTATATGGTGCTGATATCTCGAGATATCAGCACCATATAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004054.2-1624s1c1
Sequence:CCGGGCAATGGTGATGATGGATTAACTCGAGTTAATCCATCATCACCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-1079s1c1
Sequence:CCGGGAGTATGCTGTTTCTAGTCATCTCGAGATGACTAGAAACAGCATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-1114s1c1
Sequence:CCGGCCAGTTACTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-202s1c1
Sequence:CCGGCGACTCTGCTATGAAGACACTCTCGAGAGTGTCTTCATAGCAGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-677s1c1
Sequence:CCGGGCTCTGATAAAGGCCGTACAACTCGAGTTGTACGGCCTTTATCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-214s1c1
Sequence:CCGGGAAGACACTCAGGAGCAAGATCTCGAGATCTTGCTCCTGAGTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004054.2-1408s1c1
Sequence:CCGGGCAACCCAGAACAAGACTTAACTCGAGTTAAGTCTTGTTCTGGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004054.2-716s1c1
Sequence:CCGGGCGTTAATGTTGCTGGAACATCTCGAGATGTTCCAGCAACATTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-815s1c1
Sequence:CCGGGCCAAAGCACTGCTCTTATATCTCGAGATATAAGAGCAGTGCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004054.2-548s1c1
Sequence:CCGGGTGAACAAGAAGGACAAGCAACTCGAGTTGCTTGTCCTTCTTGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)