EMAIL THIS PAGE TO A FRIEND

POU2AF1

POU class 2 associating factor 1

41 Gene Product Result for
Synonyms: BOB1 OBF-1 OBF1 OCAB
UniProtKB ID: Q16633, B2R8Z9, Q14983
Gene ID:
Mouse(18985) POU domain, class 2, associating factor 1
Rat(690528) POU class 2 associating factor 1
naked mole-rat(101717233) POU class 2 associating factor 1
domestic guinea pig(100719148) POU class 2 associating factor 1
cow(528475) POU class 2 associating factor 1
sheep(101107727) POU class 2 associating factor 1
chicken(373994) POU class 2 associating factor 1
domestic cat(101091394) POU class 2 associating factor 1
dog(489413) POU class 2 associating factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034981 MISSION® esiRNA esiRNA targeting mouse Pou2af1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006235 Rosetta Predictions human pricing
NM_001109599 Rosetta Predictions rat pricing
NM_011136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136321 predicted 932
2 SASI_Hs01_00136322 predicted 599
3 SASI_Hs01_00136323 predicted 497
4 SASI_Hs01_00136324 predicted 453
5 SASI_Hs02_00341152 predicted 898
6 SASI_Hs01_00136320 predicted 690
7 SASI_Hs01_00136325 predicted 981
8 SASI_Hs01_00136326 predicted 1436
9 SASI_Hs01_00136327 predicted 1095
10 SASI_Hs01_00136329 predicted 981
11 SASI_Hs01_00136328 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249957 predicted 1247
2 SASI_Rn02_00249958 predicted 436
3 SASI_Rn02_00249959 predicted 1296
4 SASI_Rn02_00249960 predicted 1224
5 SASI_Rn02_00249961 predicted 279
6 SASI_Rn02_00249962 predicted 409
7 SASI_Rn02_00249963 predicted 1303
8 SASI_Rn02_00249964 predicted 197
9 SASI_Rn02_00249965 predicted 426
10 SASI_Rn02_00249966 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127894 predicted 412
2 SASI_Mm01_00127897 predicted 406
3 SASI_Mm01_00127898 predicted 516
4 SASI_Mm01_00127899 predicted 394
5 SASI_Mm01_00127900 predicted 522
6 SASI_Mm01_00127901 predicted 737
7 SASI_Mm01_00127902 predicted 542
8 SASI_Mm02_00319967 predicted 323
9 SASI_Mm02_00319968 predicted 1290
10 SASI_Mm02_00319969 predicted 1103
11 SASI_Mm01_00127893 predicted 310
12 SASI_Mm01_00127895 predicted 770
13 SASI_Mm01_00127896 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006235
POU2AF1 MISSION shRNA Bacterial Glycerol Stock
POU class 2 associating factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-1166s1c1
Sequence:CCGGCCAGTCCTTCAGGACATGGAACTCGAGTTCCATGTCCTGAAGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-1238s1c1
Sequence:CCGGGAAGAGGATAGCGACGCCTATCTCGAGATAGGCGTCGCTATCCTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-699s1c1
Sequence:CCGGCCTACACCACAGTGGGTCCTTCTCGAGAAGGACCCACTGTGGTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-827s1c1
Sequence:CCGGTGGACACCTTACACCGAGTATCTCGAGATACTCGGTGTAAGGTGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-966s1c1
Sequence:CCGGTCACCAATGTCACGACAAGAACTCGAGTTCTTGTCGTGACATTGGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1498s21c1
Sequence:CCGGGTGGTCCATGGGCTTTCATTTCTCGAGAAATGAAAGCCCATGGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1441s21c1
Sequence:CCGGGGGAGGTAATTATAGGGATTTCTCGAGAAATCCCTATAATTACCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1117s21c1
Sequence:CCGGTCATTTCATGACTACACTTTCCTCGAGGAAAGTGTAGTCATGAAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006235
POU2AF1 MISSION shRNA shRNA Plasmid DNA
POU class 2 associating factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-1166s1c1
Sequence:CCGGCCAGTCCTTCAGGACATGGAACTCGAGTTCCATGTCCTGAAGGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-1238s1c1
Sequence:CCGGGAAGAGGATAGCGACGCCTATCTCGAGATAGGCGTCGCTATCCTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-699s1c1
Sequence:CCGGCCTACACCACAGTGGGTCCTTCTCGAGAAGGACCCACTGTGGTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-827s1c1
Sequence:CCGGTGGACACCTTACACCGAGTATCTCGAGATACTCGGTGTAAGGTGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-966s1c1
Sequence:CCGGTCACCAATGTCACGACAAGAACTCGAGTTCTTGTCGTGACATTGGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1498s21c1
Sequence:CCGGGTGGTCCATGGGCTTTCATTTCTCGAGAAATGAAAGCCCATGGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1441s21c1
Sequence:CCGGGGGAGGTAATTATAGGGATTTCTCGAGAAATCCCTATAATTACCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1117s21c1
Sequence:CCGGTCATTTCATGACTACACTTTCCTCGAGGAAAGTGTAGTCATGAAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006235
POU2AF1 MISSION shRNA Lentiviral Transduction Particles
POU class 2 associating factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-1166s1c1
Sequence:CCGGCCAGTCCTTCAGGACATGGAACTCGAGTTCCATGTCCTGAAGGACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-1238s1c1
Sequence:CCGGGAAGAGGATAGCGACGCCTATCTCGAGATAGGCGTCGCTATCCTCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-699s1c1
Sequence:CCGGCCTACACCACAGTGGGTCCTTCTCGAGAAGGACCCACTGTGGTGTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-827s1c1
Sequence:CCGGTGGACACCTTACACCGAGTATCTCGAGATACTCGGTGTAAGGTGTCCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006235.1-966s1c1
Sequence:CCGGTCACCAATGTCACGACAAGAACTCGAGTTCTTGTCGTGACATTGGTGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1498s21c1
Sequence:CCGGGTGGTCCATGGGCTTTCATTTCTCGAGAAATGAAAGCCCATGGACCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1441s21c1
Sequence:CCGGGGGAGGTAATTATAGGGATTTCTCGAGAAATCCCTATAATTACCTCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006235.2-1117s21c1
Sequence:CCGGTCATTTCATGACTACACTTTCCTCGAGGAAAGTGTAGTCATGAAATGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011136
POU2AF1 MISSION shRNA Bacterial Glycerol Stock
POU class 2 associating factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-539s1c1
Sequence:CCGGTCACTAATGTCACGCCAAGAACTCGAGTTCTTGGCGTGACATTAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011136.1-1089s1c1
Sequence:CCGGGCGGCAAATGATAGTGATATTCTCGAGAATATCACTATCATTTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-293s1c1
Sequence:CCGGCCTGCCTTGACATGGAGGTTTCTCGAGAAACCTCCATGTCAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-739s1c1
Sequence:CCGGCCAGTCCTTCAGGACATGGATCTCGAGATCCATGTCCTGAAGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-536s1c1
Sequence:CCGGTCATCACTAATGTCACGCCAACTCGAGTTGGCGTGACATTAGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011136
POU2AF1 MISSION shRNA shRNA Plasmid DNA
POU class 2 associating factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-539s1c1
Sequence:CCGGTCACTAATGTCACGCCAAGAACTCGAGTTCTTGGCGTGACATTAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011136.1-1089s1c1
Sequence:CCGGGCGGCAAATGATAGTGATATTCTCGAGAATATCACTATCATTTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-293s1c1
Sequence:CCGGCCTGCCTTGACATGGAGGTTTCTCGAGAAACCTCCATGTCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-739s1c1
Sequence:CCGGCCAGTCCTTCAGGACATGGATCTCGAGATCCATGTCCTGAAGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-536s1c1
Sequence:CCGGTCATCACTAATGTCACGCCAACTCGAGTTGGCGTGACATTAGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011136
POU2AF1 MISSION shRNA Lentiviral Transduction Particles
POU class 2 associating factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-539s1c1
Sequence:CCGGTCACTAATGTCACGCCAAGAACTCGAGTTCTTGGCGTGACATTAGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011136.1-1089s1c1
Sequence:CCGGGCGGCAAATGATAGTGATATTCTCGAGAATATCACTATCATTTGCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-293s1c1
Sequence:CCGGCCTGCCTTGACATGGAGGTTTCTCGAGAAACCTCCATGTCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-739s1c1
Sequence:CCGGCCAGTCCTTCAGGACATGGATCTCGAGATCCATGTCCTGAAGGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011136.1-536s1c1
Sequence:CCGGTCATCACTAATGTCACGCCAACTCGAGTTGGCGTGACATTAGTGATGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)