EMAIL THIS PAGE TO A FRIEND

POU2F2

POU class 2 homeobox 2

210 Gene Product Result for
Synonyms: OCT2 OTF2 Oct-2
UniProtKB ID: P09086, Q16648, Q7M4M8, Q9BRS4
Gene ID:
Human(5452) Summary: The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(18987) POU domain, class 2, transcription factor 2
Rat(117058) POU class 2 homeobox 2
Horse(100069713) POU class 2 homeobox 2
domestic cat(101084920) POU class 2 homeobox 2
dog(484478) POU class 2 homeobox 2
naked mole-rat(101718461) POU class 2 homeobox 2
domestic guinea pig(100723701) POU class 2 homeobox 2
cow(100137901) POU class 2 homeobox 2
sheep(101104773) POU class 2 homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502254 Anti-OCT2 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, western blot pricing
SAB2501965 Anti-POU2F2 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, rat, pig
ELISA, western blot pricing
SAB2501966 Anti-POU2F2 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, pig, canine, human
ELISA, western blot pricing
SAB1409460 Anti-POU2F2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV34383 Anti-POU2F2 antibody produced in rabbit IgG fraction of antiserum canine, pig, mouse, horse, rat, guinea pig, rabbit, human
western blot pricing
SAB1411001 Anti-POU2F2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, rat, mouse
western blot pricing
HPA064404 Anti-POU2F2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA040368 Anti-POU2F2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA062096 Anti-POU2F2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0005452M1 Monoclonal Anti-POU2F2 antibody produced in mouse clone 3E3-6F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002698 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002698 Rosetta Predictions human pricing
XM_001077129 Rosetta Predictions rat pricing
XM_341802 Rosetta Predictions rat pricing
NM_011138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207633 predicted 814
2 SASI_Hs01_00207634 predicted 1031
3 SASI_Hs01_00207636 predicted 625
4 SASI_Hs01_00207637 predicted 803
5 SASI_Hs01_00207638 predicted 963
6 SASI_Hs01_00207639 predicted 238
7 SASI_Hs01_00207640 predicted 820
8 SASI_Hs01_00207641 predicted 430
9 SASI_Hs01_00207642 predicted 741
10 SASI_Hs02_00334273 predicted 336
11 SASI_Hs01_00207635 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355914 predicted 1058
2 SASI_Rn02_00355915 predicted 875
3 SASI_Rn02_00355916 predicted 869
4 SASI_Rn02_00355917 predicted 759
5 SASI_Rn02_00355918 predicted 694
6 SASI_Rn02_00355919 predicted 743
7 SASI_Rn02_00355920 predicted 763
8 SASI_Rn02_00355921 predicted 462
9 SASI_Rn02_00355922 predicted 572
10 SASI_Rn02_00355923 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393353 predicted 1143
2 SASI_Rn02_00393354 predicted 869
3 SASI_Rn02_00393355 predicted 871
4 SASI_Rn02_00393356 predicted 763
5 SASI_Rn02_00393357 predicted 108
6 SASI_Rn02_00393358 predicted 420
7 SASI_Rn02_00393359 predicted 503
8 SASI_Rn02_00393360 predicted 106
9 SASI_Rn02_00393361 predicted 277
10 SASI_Rn02_00393362 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048966 predicted 916
2 SASI_Mm01_00048967 predicted 620
3 SASI_Mm01_00048968 predicted 917
4 SASI_Mm01_00048969 predicted 807
5 SASI_Mm01_00048970 predicted 792
6 SASI_Mm01_00048971 predicted 591
7 SASI_Mm01_00048972 predicted 462
8 SASI_Mm01_00048973 predicted 1025
9 SASI_Mm01_00048974 predicted 954
10 SASI_Mm01_00048975 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011138
POU2F2 MISSION shRNA Bacterial Glycerol Stock
POU class 2 homeobox 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011138.1-1503s1c1
Sequence:CCGGCTTAGTAACCTCGCCTCTCTTCTCGAGAAGAGAGGCGAGGTTACTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-1196s1c1
Sequence:CCGGGAGCACAACAGTTACTACCTTCTCGAGAAGGTAGTAACTGTTGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-119s1c1
Sequence:CCGGACCCGACATTAACCATCAGAACTCGAGTTCTGATGGTTAATGTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-935s1c1
Sequence:CCGGCTTCGCCTTAGAGAAGAGTTTCTCGAGAAACTCTTCTCTAAGGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-695s1c1
Sequence:CCGGCAAGCTCTATGGCAACGACTTCTCGAGAAGTCGTTGCCATAGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-803s21c1
Sequence:CCGGCAACGACGCAGAGACTATGTCCTCGAGGACATAGTCTCTGCGTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-911s21c1
Sequence:CCGGGACCAGCATCGAGACGAATGTCTCGAGACATTCGTCTCGATGCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-93s21c1
Sequence:CCGGGAGCACACAGACACCGAAAGACTCGAGTCTTTCGGTGTCTGTGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-422s21c1
Sequence:CCGGGCTACCAACGCCAAATCTATTCTCGAGAATAGATTTGGCGTTGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011138
POU2F2 MISSION shRNA shRNA Plasmid DNA
POU class 2 homeobox 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011138.1-1503s1c1
Sequence:CCGGCTTAGTAACCTCGCCTCTCTTCTCGAGAAGAGAGGCGAGGTTACTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-1196s1c1
Sequence:CCGGGAGCACAACAGTTACTACCTTCTCGAGAAGGTAGTAACTGTTGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-119s1c1
Sequence:CCGGACCCGACATTAACCATCAGAACTCGAGTTCTGATGGTTAATGTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-935s1c1
Sequence:CCGGCTTCGCCTTAGAGAAGAGTTTCTCGAGAAACTCTTCTCTAAGGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-695s1c1
Sequence:CCGGCAAGCTCTATGGCAACGACTTCTCGAGAAGTCGTTGCCATAGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-803s21c1
Sequence:CCGGCAACGACGCAGAGACTATGTCCTCGAGGACATAGTCTCTGCGTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-911s21c1
Sequence:CCGGGACCAGCATCGAGACGAATGTCTCGAGACATTCGTCTCGATGCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-93s21c1
Sequence:CCGGGAGCACACAGACACCGAAAGACTCGAGTCTTTCGGTGTCTGTGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-422s21c1
Sequence:CCGGGCTACCAACGCCAAATCTATTCTCGAGAATAGATTTGGCGTTGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011138
POU2F2 MISSION shRNA Lentiviral Transduction Particles
POU class 2 homeobox 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011138.1-1503s1c1
Sequence:CCGGCTTAGTAACCTCGCCTCTCTTCTCGAGAAGAGAGGCGAGGTTACTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-1196s1c1
Sequence:CCGGGAGCACAACAGTTACTACCTTCTCGAGAAGGTAGTAACTGTTGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-119s1c1
Sequence:CCGGACCCGACATTAACCATCAGAACTCGAGTTCTGATGGTTAATGTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-935s1c1
Sequence:CCGGCTTCGCCTTAGAGAAGAGTTTCTCGAGAAACTCTTCTCTAAGGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011138.1-695s1c1
Sequence:CCGGCAAGCTCTATGGCAACGACTTCTCGAGAAGTCGTTGCCATAGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-803s21c1
Sequence:CCGGCAACGACGCAGAGACTATGTCCTCGAGGACATAGTCTCTGCGTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-911s21c1
Sequence:CCGGGACCAGCATCGAGACGAATGTCTCGAGACATTCGTCTCGATGCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-93s21c1
Sequence:CCGGGAGCACACAGACACCGAAAGACTCGAGTCTTTCGGTGTCTGTGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011138.2-422s21c1
Sequence:CCGGGCTACCAACGCCAAATCTATTCTCGAGAATAGATTTGGCGTTGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002698
POU2F2 MISSION shRNA Bacterial Glycerol Stock
POU class 2 homeobox 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002698.1-1635s1c1
Sequence:CCGGCCTCATCCTCTTCATCCTCATCTCGAGATGAGGATGAAGAGGATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-141s1c1
Sequence:CCGGGCACACAGACACCGAAAGAAACTCGAGTTTCTTTCGGTGTCTGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-468s1c1
Sequence:CCGGGCTACCGACACCAAATCTATTCTCGAGAATAGATTTGGTGTCGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-1196s1c1
Sequence:CCGGGCACAACAGTTACTACCTTATCTCGAGATAAGGTAGTAACTGTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-481s21c1
Sequence:CCGGGCTACCGACACCAAATCTATTCTCGAGAATAGATTTGGTGTCGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-1201s21c1
Sequence:CCGGCAGTCTGAGCACAACAGTTACCTCGAGGTAACTGTTGTGCTCAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002698.2-2100s21c1
Sequence:CCGGTCACTGCTACGACGCCAAATACTCGAGTATTTGGCGTCGTAGCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-723s21c1
Sequence:CCGGACTTCAGCCAGACGACCATTTCTCGAGAAATGGTCGTCTGGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-171s21c1
Sequence:CCGGGAAATGGACCAGACACTAATCCTCGAGGATTAGTGTCTGGTCCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002698
POU2F2 MISSION shRNA shRNA Plasmid DNA
POU class 2 homeobox 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002698.1-1635s1c1
Sequence:CCGGCCTCATCCTCTTCATCCTCATCTCGAGATGAGGATGAAGAGGATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-141s1c1
Sequence:CCGGGCACACAGACACCGAAAGAAACTCGAGTTTCTTTCGGTGTCTGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-468s1c1
Sequence:CCGGGCTACCGACACCAAATCTATTCTCGAGAATAGATTTGGTGTCGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-1196s1c1
Sequence:CCGGGCACAACAGTTACTACCTTATCTCGAGATAAGGTAGTAACTGTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-481s21c1
Sequence:CCGGGCTACCGACACCAAATCTATTCTCGAGAATAGATTTGGTGTCGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-1201s21c1
Sequence:CCGGCAGTCTGAGCACAACAGTTACCTCGAGGTAACTGTTGTGCTCAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002698.2-2100s21c1
Sequence:CCGGTCACTGCTACGACGCCAAATACTCGAGTATTTGGCGTCGTAGCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-723s21c1
Sequence:CCGGACTTCAGCCAGACGACCATTTCTCGAGAAATGGTCGTCTGGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-171s21c1
Sequence:CCGGGAAATGGACCAGACACTAATCCTCGAGGATTAGTGTCTGGTCCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002698
POU2F2 MISSION shRNA Lentiviral Transduction Particles
POU class 2 homeobox 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002698.1-1635s1c1
Sequence:CCGGCCTCATCCTCTTCATCCTCATCTCGAGATGAGGATGAAGAGGATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-141s1c1
Sequence:CCGGGCACACAGACACCGAAAGAAACTCGAGTTTCTTTCGGTGTCTGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-468s1c1
Sequence:CCGGGCTACCGACACCAAATCTATTCTCGAGAATAGATTTGGTGTCGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002698.1-1196s1c1
Sequence:CCGGGCACAACAGTTACTACCTTATCTCGAGATAAGGTAGTAACTGTTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-481s21c1
Sequence:CCGGGCTACCGACACCAAATCTATTCTCGAGAATAGATTTGGTGTCGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-1201s21c1
Sequence:CCGGCAGTCTGAGCACAACAGTTACCTCGAGGTAACTGTTGTGCTCAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002698.2-2100s21c1
Sequence:CCGGTCACTGCTACGACGCCAAATACTCGAGTATTTGGCGTCGTAGCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-723s21c1
Sequence:CCGGACTTCAGCCAGACGACCATTTCTCGAGAAATGGTCGTCTGGCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002698.2-171s21c1
Sequence:CCGGGAAATGGACCAGACACTAATCCTCGAGGATTAGTGTCTGGTCCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)