EMAIL THIS PAGE TO A FRIEND

POU3F1

POU class 3 homeobox 1

123 Gene Product Result for
Synonyms: OCT6 OTF6 SCIP
UniProtKB ID: Q03052, Q5TAG2
Gene ID:
Mouse(18991) POU domain, class 3, transcription factor 1
Rat(192110) POU class 3 homeobox 1
cow(617830) POU class 3 homeobox 1
domestic guinea pig(100722771) POU class 3 homeobox 1
Zebrafish(30398) POU class 3 homeobox 1
dog(482468) POU class 3 homeobox 1
chicken(430270) POU domain, class 3, transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU175461 MISSION® esiRNA esiRNA targeting mouse ENSMUSG00000078236 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002699 Rosetta Predictions human pricing
NM_138838 Rosetta Predictions rat pricing
NM_011141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067814 predicted 1085
2 SASI_Hs01_00067816 predicted 1090
3 SASI_Hs01_00067817 predicted 1051
4 SASI_Hs02_00334274 predicted 1775
5 SASI_Hs02_00334275 predicted 2623
6 SASI_Hs02_00334276 predicted 2414
7 SASI_Hs02_00334277 predicted 2553
8 SASI_Hs02_00334278 predicted 2556
9 SASI_Hs02_00334279 predicted 2639
10 SASI_Hs02_00334280 predicted 2548
11 SASI_Hs01_00067815 predicted 1097
12 SASI_Hs01_00067818 predicted 1081
13 SASI_Hs01_00067819 predicted 1083
14 SASI_Hs01_00067820 predicted 1051
15 SASI_Hs01_00067821 predicted 1093
16 SASI_Hs01_00067822 predicted 1095
17 SASI_Hs01_00067823 predicted 1849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089903 predicted 874
2 SASI_Rn01_00089904 predicted 1051
3 SASI_Rn01_00089905 predicted 1052
4 SASI_Rn01_00089907 predicted 1062
5 SASI_Rn01_00089908 predicted 1766
6 SASI_Rn01_00089909 predicted 321
7 SASI_Rn01_00089910 predicted 1847
8 SASI_Rn01_00089911 predicted 1071
9 SASI_Rn01_00089912 predicted 1103
10 SASI_Rn02_00268218 predicted 1080
11 SASI_Rn01_00089906 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319981 predicted 899
2 SASI_Mm01_00023593 predicted 1072
3 SASI_Mm02_00319982 predicted 1905
4 SASI_Mm02_00319983 predicted 1874
5 SASI_Mm01_00023595 predicted 1076
6 SASI_Mm01_00023596 predicted 1097
7 SASI_Mm01_00023597 predicted 1114
8 SASI_Mm02_00319984 predicted 1065
9 SASI_Mm02_00319985 predicted 1106
10 SASI_Mm02_00319986 predicted 1085
11 SASI_Mm01_00023589 predicted 1103
12 SASI_Mm01_00023590 predicted 305
13 SASI_Mm01_00023591 predicted 1117
14 SASI_Mm01_00023592 predicted 1109
15 SASI_Mm01_00023594 predicted 305
16 SASI_Mm01_00023598 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002699
POU3F1 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002699.2-293s1c1
Sequence:CCGGCGCGCACCTAGAACACGGCAACTCGAGTTGCCGTGTTCTAGGTGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002699.2-1496s1c1
Sequence:CCGGGCCCAGAAACTTTCGAACAAACTCGAGTTTGTTCGAAAGTTTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002699.3-1055s21c1
Sequence:CCGGCAAGAAGCGCACGTCCATCGACTCGAGTCGATGGACGTGCGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002699.3-1208s21c1
Sequence:CCGGGCAGAAGGAGAAGCGCATGACCTCGAGGTCATGCGCTTCTCCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002699.3-1866s21c1
Sequence:CCGGTTATTCGCTACACGCCTCTTCCTCGAGGAAGAGGCGTGTAGCGAATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002699.2-594s1c1
Sequence:CCGGCACCACGCGCTGCACGAGGATCTCGAGATCCTCGTGCAGCGCGTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002699
POU3F1 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002699.2-293s1c1
Sequence:CCGGCGCGCACCTAGAACACGGCAACTCGAGTTGCCGTGTTCTAGGTGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002699.2-1496s1c1
Sequence:CCGGGCCCAGAAACTTTCGAACAAACTCGAGTTTGTTCGAAAGTTTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002699.3-1055s21c1
Sequence:CCGGCAAGAAGCGCACGTCCATCGACTCGAGTCGATGGACGTGCGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002699.3-1208s21c1
Sequence:CCGGGCAGAAGGAGAAGCGCATGACCTCGAGGTCATGCGCTTCTCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002699.3-1866s21c1
Sequence:CCGGTTATTCGCTACACGCCTCTTCCTCGAGGAAGAGGCGTGTAGCGAATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002699.2-594s1c1
Sequence:CCGGCACCACGCGCTGCACGAGGATCTCGAGATCCTCGTGCAGCGCGTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002699
POU3F1 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002699.2-293s1c1
Sequence:CCGGCGCGCACCTAGAACACGGCAACTCGAGTTGCCGTGTTCTAGGTGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002699.2-1496s1c1
Sequence:CCGGGCCCAGAAACTTTCGAACAAACTCGAGTTTGTTCGAAAGTTTCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002699.3-1055s21c1
Sequence:CCGGCAAGAAGCGCACGTCCATCGACTCGAGTCGATGGACGTGCGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002699.3-1208s21c1
Sequence:CCGGGCAGAAGGAGAAGCGCATGACCTCGAGGTCATGCGCTTCTCCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002699.3-1866s21c1
Sequence:CCGGTTATTCGCTACACGCCTCTTCCTCGAGGAAGAGGCGTGTAGCGAATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002699.2-594s1c1
Sequence:CCGGCACCACGCGCTGCACGAGGATCTCGAGATCCTCGTGCAGCGCGTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011141
POU3F1 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-828s1c1
Sequence:CCGGGCAGTTCAAGCAACGACGCATCTCGAGATGCGTCGTTGCTTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-1264s1c1
Sequence:CCGGCCGCCCATGGACGACGTTTATCTCGAGATAAACGTCGTCCATGGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-1116s1c1
Sequence:CCGGCCACTTTCTCAAGTGTCCCAACTCGAGTTGGGACACTTGAGAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-427s1c1
Sequence:CCGGGCATGGGCACAAGGCGGCACACTCGAGTGTGCCGCCTTGTGCCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-254s1c1
Sequence:CCGGCGCACCCTCAATGGCTACCCACTCGAGTGGGTAGCCATTGAGGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011141.2-900s21c1
Sequence:CCGGCCCTCTACGGTAACGTGTTCTCTCGAGAGAACACGTTACCGTAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011141.2-1651s21c1
Sequence:CCGGAGCAGCGGAAGATCCAGAATGCTCGAGCATTCTGGATCTTCCGCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011141.2-196s21c1
Sequence:CCGGCGAAGTGCAGAAGCTGATGCACTCGAGTGCATCAGCTTCTGCACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011141
POU3F1 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-828s1c1
Sequence:CCGGGCAGTTCAAGCAACGACGCATCTCGAGATGCGTCGTTGCTTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-1264s1c1
Sequence:CCGGCCGCCCATGGACGACGTTTATCTCGAGATAAACGTCGTCCATGGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-1116s1c1
Sequence:CCGGCCACTTTCTCAAGTGTCCCAACTCGAGTTGGGACACTTGAGAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-427s1c1
Sequence:CCGGGCATGGGCACAAGGCGGCACACTCGAGTGTGCCGCCTTGTGCCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-254s1c1
Sequence:CCGGCGCACCCTCAATGGCTACCCACTCGAGTGGGTAGCCATTGAGGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011141.2-900s21c1
Sequence:CCGGCCCTCTACGGTAACGTGTTCTCTCGAGAGAACACGTTACCGTAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011141.2-1651s21c1
Sequence:CCGGAGCAGCGGAAGATCCAGAATGCTCGAGCATTCTGGATCTTCCGCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011141.2-196s21c1
Sequence:CCGGCGAAGTGCAGAAGCTGATGCACTCGAGTGCATCAGCTTCTGCACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011141
POU3F1 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-828s1c1
Sequence:CCGGGCAGTTCAAGCAACGACGCATCTCGAGATGCGTCGTTGCTTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-1264s1c1
Sequence:CCGGCCGCCCATGGACGACGTTTATCTCGAGATAAACGTCGTCCATGGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-1116s1c1
Sequence:CCGGCCACTTTCTCAAGTGTCCCAACTCGAGTTGGGACACTTGAGAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-427s1c1
Sequence:CCGGGCATGGGCACAAGGCGGCACACTCGAGTGTGCCGCCTTGTGCCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011141.1-254s1c1
Sequence:CCGGCGCACCCTCAATGGCTACCCACTCGAGTGGGTAGCCATTGAGGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011141.2-900s21c1
Sequence:CCGGCCCTCTACGGTAACGTGTTCTCTCGAGAGAACACGTTACCGTAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011141.2-1651s21c1
Sequence:CCGGAGCAGCGGAAGATCCAGAATGCTCGAGCATTCTGGATCTTCCGCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011141.2-196s21c1
Sequence:CCGGCGAAGTGCAGAAGCTGATGCACTCGAGTGCATCAGCTTCTGCACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)