EMAIL THIS PAGE TO A FRIEND

POU3F2

POU class 3 homeobox 2

222 Gene Product Result for
Synonyms: BRN2 N-Oct3 OCT7 OTF-7 OTF7 POUF3 brn-2 oct-7
UniProtKB ID: P20265, Q14960, Q86V54, Q9UJL0
Gene ID:
Human(5454) Summary: This gene encodes a member of the POU-III class of neural transcription factors. The encoded protein is involved in neuronal differentiation and enhances the activation of corticotropin-releasing hormone regulated genes. Overexpression of this protein is associated with an increase in the proliferation of melanoma cells. [provided by RefSeq, Mar 2012]
Mouse(18992) POU domain, class 3, transcription factor 2
Rat(29588) POU class 3 homeobox 2
dog(481931) POU class 3 homeobox 2
domestic guinea pig(100723441) POU class 3 homeobox 2
naked mole-rat(101717609) POU class 3 homeobox 2
cow(783320) POU class 3 homeobox 2
sheep(101112574) POU class 3 homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV100858 Anti-POU3F2 (AB1) antibody produced in rabbit affinity isolated antibody pig, rat, human, bovine
western blot pricing
AV31218 Anti-POU3F2 (AB2) antibody produced in rabbit affinity isolated antibody bovine, dog, human, rat, mouse, guinea pig
immunohistochemistry, western blot pricing
SAB2501452 Anti-POU3F2 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, rabbit, bovine, rat, bovine, human, mouse
ELISA, western blot pricing
SAB2702086 Anti-POU3F2 antibody produced in rabbit rat, mouse, human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA056261 Anti-POU3F2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
AMAB91406 Monoclonal Anti-POU3F2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL6228, purified immunoglobulin, buffered aqueous glycerol solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0005454M1 Monoclonal Anti-POU3F2 antibody produced in mouse clone 6F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB91407 Monoclonal Anti-POU3F2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL6232, purified immunoglobulin, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry pricing
SAB1404227 Monoclonal Anti-POU3F2, (N-terminal) antibody produced in mouse clone 1H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005604 Rosetta Predictions human pricing
NM_172085 Rosetta Predictions rat pricing
NM_008899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196791 predicted 1986
2 SASI_Hs01_00196792 predicted 1006
3 SASI_Hs01_00196793 predicted 1677
4 SASI_Hs01_00196794 predicted 1657
5 SASI_Hs01_00196796 predicted 1671
6 SASI_Hs01_00196797 predicted 1664
7 SASI_Hs01_00196798 predicted 1479
8 SASI_Hs01_00196799 predicted 297
9 SASI_Hs01_00196800 predicted 1266
10 SASI_Hs02_00339919 predicted 1564
11 SASI_Hs01_00196795 predicted 1902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269178 predicted 1036
2 SASI_Rn02_00269179 predicted 960
3 SASI_Rn02_00269180 predicted 919
4 SASI_Rn02_00269181 predicted 1182
5 SASI_Rn02_00269182 predicted 916
6 SASI_Rn02_00269183 predicted 1000
7 SASI_Rn02_00269184 predicted 1037
8 SASI_Rn02_00269185 predicted 909
9 SASI_Rn02_00269186 predicted 914
10 SASI_Rn02_00269187 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082680 predicted 855
2 SASI_Mm01_00082681 predicted 887
3 SASI_Mm01_00082682 predicted 840
4 SASI_Mm01_00082683 predicted 841
5 SASI_Mm01_00082684 predicted 1113
6 SASI_Mm01_00082685 predicted 845
7 SASI_Mm01_00082686 predicted 840
8 SASI_Mm01_00082687 predicted 929
9 SASI_Mm01_00082688 predicted 970
10 SASI_Mm01_00082689 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008899
POU3F2 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-817s21c1
Sequence:CCGGGAGCAGTTCGCCAAGCAATTCCTCGAGGAATTGCTTGGCGAACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-369s21c1
Sequence:CCGGGCTGCAGCAACAGCATCAACACTCGAGTGTTGATGCTGTTGCTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-1112s21c1
Sequence:CCGGTGGAGAGCCATTTCCTCAAATCTCGAGATTTGAGGAAATGGCTCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-844s1c1
Sequence:CCGGAGGCGGATCAAACTCGGATTTCTCGAGAAATCCGAGTTTGATCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-975s1c1
Sequence:CCGGGCTGAAGCCTTTGTTGAACAACTCGAGTTGTTCAACAAAGGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-847s1c1
Sequence:CCGGCGGATCAAACTCGGATTTACTCTCGAGAGTAAATCCGAGTTTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-300s1c1
Sequence:CCGGGCCGGACATCAAGCCCTCGGTCTCGAGACCGAGGGCTTGATGTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-579s1c1
Sequence:CCGGGCAGCCGAGCTTCACGGTGAACTCGAGTTCACCGTGAAGCTCGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008899
POU3F2 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-817s21c1
Sequence:CCGGGAGCAGTTCGCCAAGCAATTCCTCGAGGAATTGCTTGGCGAACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-369s21c1
Sequence:CCGGGCTGCAGCAACAGCATCAACACTCGAGTGTTGATGCTGTTGCTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-1112s21c1
Sequence:CCGGTGGAGAGCCATTTCCTCAAATCTCGAGATTTGAGGAAATGGCTCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-844s1c1
Sequence:CCGGAGGCGGATCAAACTCGGATTTCTCGAGAAATCCGAGTTTGATCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-975s1c1
Sequence:CCGGGCTGAAGCCTTTGTTGAACAACTCGAGTTGTTCAACAAAGGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-847s1c1
Sequence:CCGGCGGATCAAACTCGGATTTACTCTCGAGAGTAAATCCGAGTTTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-300s1c1
Sequence:CCGGGCCGGACATCAAGCCCTCGGTCTCGAGACCGAGGGCTTGATGTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-579s1c1
Sequence:CCGGGCAGCCGAGCTTCACGGTGAACTCGAGTTCACCGTGAAGCTCGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008899
POU3F2 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-817s21c1
Sequence:CCGGGAGCAGTTCGCCAAGCAATTCCTCGAGGAATTGCTTGGCGAACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-369s21c1
Sequence:CCGGGCTGCAGCAACAGCATCAACACTCGAGTGTTGATGCTGTTGCTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008899.1-1112s21c1
Sequence:CCGGTGGAGAGCCATTTCCTCAAATCTCGAGATTTGAGGAAATGGCTCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-844s1c1
Sequence:CCGGAGGCGGATCAAACTCGGATTTCTCGAGAAATCCGAGTTTGATCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-975s1c1
Sequence:CCGGGCTGAAGCCTTTGTTGAACAACTCGAGTTGTTCAACAAAGGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-847s1c1
Sequence:CCGGCGGATCAAACTCGGATTTACTCTCGAGAGTAAATCCGAGTTTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-300s1c1
Sequence:CCGGGCCGGACATCAAGCCCTCGGTCTCGAGACCGAGGGCTTGATGTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008899.1-579s1c1
Sequence:CCGGGCAGCCGAGCTTCACGGTGAACTCGAGTTCACCGTGAAGCTCGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005604
VALIDATED
POU3F2 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1141s21c1
Sequence:GTACCGGTGAAGCCTTTGTTGAACAAGTCTCGAGACTTGTTCAACAAAGGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005604.2-3427s21c1
Sequence:CCGGGACTTATAATGGGCATATTTACTCGAGTAAATATGCCCATTATAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1351s21c1
Sequence:CCGGAGAAGGAGGTGGTGAGAGTTTCTCGAGAAACTCTCACCACCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1276s21c1
Sequence:CCGGTGGAGAGCCATTTCCTCAAATCTCGAGATTTGAGGAAATGGCTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1010s21c1
Sequence:CCGGGCGGATCAAACTGGGATTTACCTCGAGGTAAATCCCAGTTTGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005604.1-1137s1c1
Sequence:CCGGGCCTTTGTTGAACAAGTGGTTCTCGAGAACCACTTGTTCAACAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005604.1-1572s1c1
Sequence:CCGGCCTCTCTAACTTCTGATTGTTCTCGAGAACAATCAGAAGTTAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005604.1-1348s1c1
Sequence:CCGGGAGGTGGTGAGAGTTTGGTTTCTCGAGAAACCAAACTCTCACCACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005604.1-1000s1c1
Sequence:CCGGCGGCGGATCAAACTGGGATTTCTCGAGAAATCCCAGTTTGATCCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005604
VALIDATED
POU3F2 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1141s21c1
Sequence:GTACCGGTGAAGCCTTTGTTGAACAAGTCTCGAGACTTGTTCAACAAAGGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005604.2-3427s21c1
Sequence:CCGGGACTTATAATGGGCATATTTACTCGAGTAAATATGCCCATTATAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1351s21c1
Sequence:CCGGAGAAGGAGGTGGTGAGAGTTTCTCGAGAAACTCTCACCACCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1276s21c1
Sequence:CCGGTGGAGAGCCATTTCCTCAAATCTCGAGATTTGAGGAAATGGCTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1010s21c1
Sequence:CCGGGCGGATCAAACTGGGATTTACCTCGAGGTAAATCCCAGTTTGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005604.1-1137s1c1
Sequence:CCGGGCCTTTGTTGAACAAGTGGTTCTCGAGAACCACTTGTTCAACAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005604.1-1572s1c1
Sequence:CCGGCCTCTCTAACTTCTGATTGTTCTCGAGAACAATCAGAAGTTAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005604.1-1348s1c1
Sequence:CCGGGAGGTGGTGAGAGTTTGGTTTCTCGAGAAACCAAACTCTCACCACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005604.1-1000s1c1
Sequence:CCGGCGGCGGATCAAACTGGGATTTCTCGAGAAATCCCAGTTTGATCCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005604
VALIDATED
POU3F2 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1141s21c1
Sequence:GTACCGGTGAAGCCTTTGTTGAACAAGTCTCGAGACTTGTTCAACAAAGGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005604.2-3427s21c1
Sequence:CCGGGACTTATAATGGGCATATTTACTCGAGTAAATATGCCCATTATAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1351s21c1
Sequence:CCGGAGAAGGAGGTGGTGAGAGTTTCTCGAGAAACTCTCACCACCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1276s21c1
Sequence:CCGGTGGAGAGCCATTTCCTCAAATCTCGAGATTTGAGGAAATGGCTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005604.2-1010s21c1
Sequence:CCGGGCGGATCAAACTGGGATTTACCTCGAGGTAAATCCCAGTTTGATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005604.1-1137s1c1
Sequence:CCGGGCCTTTGTTGAACAAGTGGTTCTCGAGAACCACTTGTTCAACAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005604.1-1572s1c1
Sequence:CCGGCCTCTCTAACTTCTGATTGTTCTCGAGAACAATCAGAAGTTAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005604.1-1348s1c1
Sequence:CCGGGAGGTGGTGAGAGTTTGGTTTCTCGAGAAACCAAACTCTCACCACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005604.1-1000s1c1
Sequence:CCGGCGGCGGATCAAACTGGGATTTCTCGAGAAATCCCAGTTTGATCCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)