EMAIL THIS PAGE TO A FRIEND

POU3F3

POU class 3 homeobox 3

45 Gene Product Result for
Synonyms: BRN1 OTF8
UniProtKB ID: P20264, P78379, Q4ZG25
Gene ID:
Human(5455) Summary: POU3F3 is a member of the class III POU family of transcription factors (see POU3F1; MIM 602479) that are expressed in the central nervous system. The POU domain in these proteins is required for high affinity binding to octamer DNA sequences (summarized by Sumiyama et al., 1996 [PubMed 8703082]
Mouse(18993) POU domain, class 3, transcription factor 3
Rat(192109) POU class 3 homeobox 3
domestic cat(101084097) POU class 3 homeobox 3
cow(526152) uncharacterized LOC526152
naked mole-rat(101716926) POU class 3 homeobox 3
domestic guinea pig(100727958) POU class 3 homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006236 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006236 Rosetta Predictions human pricing
NM_138837 Rosetta Predictions rat pricing
NM_008900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177279 predicted 1248
2 SASI_Hs01_00177280 predicted 1148
3 SASI_Hs01_00177281 predicted 1244
4 SASI_Hs01_00177282 predicted 1241
5 SASI_Hs01_00177283 predicted 1042
6 SASI_Hs01_00177284 predicted 1386
7 SASI_Hs01_00177285 predicted 1041
8 SASI_Hs01_00177286 predicted 246
9 SASI_Hs01_00177287 predicted 202
10 SASI_Hs01_00177288 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052359 predicted 2045
2 SASI_Rn01_00052360 predicted 1950
3 SASI_Rn01_00052361 predicted 1952
4 SASI_Rn02_00268216 predicted 1964
5 SASI_Rn01_00052362 predicted 1954
6 SASI_Rn01_00052363 predicted 1947
7 SASI_Rn01_00052364 predicted 2007
8 SASI_Rn01_00052365 predicted 1956
9 SASI_Rn01_00052366 predicted 2045
10 SASI_Rn02_00268217 predicted 1835
11 SASI_Rn01_00052367 predicted 1291
12 SASI_Rn01_00052368 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025202 predicted 1256
2 SASI_Mm02_00314912 predicted 1294
3 SASI_Mm01_00025207 predicted 1110
4 SASI_Mm01_00025208 predicted 1269
5 SASI_Mm02_00314913 predicted 1768
6 SASI_Mm02_00314914 predicted 1887
7 SASI_Mm02_00314915 predicted 1951
8 SASI_Mm02_00314916 predicted 1883
9 SASI_Mm02_00314917 predicted 1777
10 SASI_Mm02_00314918 predicted 1468
11 SASI_Mm01_00025203 predicted 1080
12 SASI_Mm01_00025204 predicted 1088
13 SASI_Mm01_00025205 predicted 1160
14 SASI_Mm01_00025206 predicted 1163
15 SASI_Mm01_00025209 predicted 1145
16 SASI_Mm01_00025210 predicted 1079
17 SASI_Mm01_00025211 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008900
VALIDATED
POU3F3 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008900.1-1254s1c1
Sequence:CCGGCCACTTCCTCAAGTGCCCTAACTCGAGTTAGGGCACTTGAGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-793s1c1
Sequence:CCGGGCGGAGCATCATCACCACCATCTCGAGATGGTGGTGATGATGCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-1083s1c1
Sequence:CCGGGCAGCTCAGTTTCAAGAACATCTCGAGATGTTCTTGAAACTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008900.1-638s1c1
Sequence:CCGGCGCCGCAGAGTCTGCTGTACTCTCGAGAGTACAGCAGACTCTGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-1219s1c1
Sequence:CCGGTCCATCGAGGTTAGCGTCAAACTCGAGTTTGACGCTAACCTCGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-1287s21c1
Sequence:CCGGGGCGCAGGAAATCACCAACTTCTCGAGAAGTTGGTGATTTCCTGCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008900.2-1952s21c1
Sequence:CCGGAGATGCCTAACGCACCTAAACCTCGAGGTTTAGGTGCGTTAGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-644s21c1
Sequence:CCGGCGCCGCAGAGTCTGCTGTACTCTCGAGAGTACAGCAGACTCTGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-962s21c1
Sequence:CCGGAGTTCGCTAAGCAGTTCAAACCTCGAGGTTTGAACTGCTTAGCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008900.2-1891s21c1
Sequence:CCGGCAACAGGGACATCTCGTTTATCTCGAGATAAACGAGATGTCCCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-210s21c1
Sequence:CCGGGATGGTCCAGAGCGACTTCATCTCGAGATGAAGTCGCTCTGGACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-1476s21c1
Sequence:CCGGTCAGACCAGCGTGCAGTGAATCTCGAGATTCACTGCACGCTGGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008900
VALIDATED
POU3F3 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008900.1-1254s1c1
Sequence:CCGGCCACTTCCTCAAGTGCCCTAACTCGAGTTAGGGCACTTGAGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-793s1c1
Sequence:CCGGGCGGAGCATCATCACCACCATCTCGAGATGGTGGTGATGATGCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-1083s1c1
Sequence:CCGGGCAGCTCAGTTTCAAGAACATCTCGAGATGTTCTTGAAACTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008900.1-638s1c1
Sequence:CCGGCGCCGCAGAGTCTGCTGTACTCTCGAGAGTACAGCAGACTCTGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-1219s1c1
Sequence:CCGGTCCATCGAGGTTAGCGTCAAACTCGAGTTTGACGCTAACCTCGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-1287s21c1
Sequence:CCGGGGCGCAGGAAATCACCAACTTCTCGAGAAGTTGGTGATTTCCTGCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008900.2-1952s21c1
Sequence:CCGGAGATGCCTAACGCACCTAAACCTCGAGGTTTAGGTGCGTTAGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-644s21c1
Sequence:CCGGCGCCGCAGAGTCTGCTGTACTCTCGAGAGTACAGCAGACTCTGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-962s21c1
Sequence:CCGGAGTTCGCTAAGCAGTTCAAACCTCGAGGTTTGAACTGCTTAGCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008900.2-1891s21c1
Sequence:CCGGCAACAGGGACATCTCGTTTATCTCGAGATAAACGAGATGTCCCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-210s21c1
Sequence:CCGGGATGGTCCAGAGCGACTTCATCTCGAGATGAAGTCGCTCTGGACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-1476s21c1
Sequence:CCGGTCAGACCAGCGTGCAGTGAATCTCGAGATTCACTGCACGCTGGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008900
VALIDATED
POU3F3 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008900.1-1254s1c1
Sequence:CCGGCCACTTCCTCAAGTGCCCTAACTCGAGTTAGGGCACTTGAGGAAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-793s1c1
Sequence:CCGGGCGGAGCATCATCACCACCATCTCGAGATGGTGGTGATGATGCTCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-1083s1c1
Sequence:CCGGGCAGCTCAGTTTCAAGAACATCTCGAGATGTTCTTGAAACTGAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008900.1-638s1c1
Sequence:CCGGCGCCGCAGAGTCTGCTGTACTCTCGAGAGTACAGCAGACTCTGCGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008900.1-1219s1c1
Sequence:CCGGTCCATCGAGGTTAGCGTCAAACTCGAGTTTGACGCTAACCTCGATGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-1287s21c1
Sequence:CCGGGGCGCAGGAAATCACCAACTTCTCGAGAAGTTGGTGATTTCCTGCGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008900.2-1952s21c1
Sequence:CCGGAGATGCCTAACGCACCTAAACCTCGAGGTTTAGGTGCGTTAGGCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-644s21c1
Sequence:CCGGCGCCGCAGAGTCTGCTGTACTCTCGAGAGTACAGCAGACTCTGCGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-962s21c1
Sequence:CCGGAGTTCGCTAAGCAGTTCAAACCTCGAGGTTTGAACTGCTTAGCGAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008900.2-1891s21c1
Sequence:CCGGCAACAGGGACATCTCGTTTATCTCGAGATAAACGAGATGTCCCTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-210s21c1
Sequence:CCGGGATGGTCCAGAGCGACTTCATCTCGAGATGAAGTCGCTCTGGACCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008900.2-1476s21c1
Sequence:CCGGTCAGACCAGCGTGCAGTGAATCTCGAGATTCACTGCACGCTGGTCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006236
POU3F3 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-647s1c1
Sequence:CCGGCGCCGCAGAGTCTGCTCTACTCTCGAGAGTAGAGCAGACTCTGCGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-213s1c1
Sequence:CCGGGATGGTCCAGAGCGACTTCATCTCGAGATGAAGTCGCTCTGGACCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-672s1c1
Sequence:CCGGGCCCGGAGGCTTCACGGTGAACTCGAGTTCACCGTGAAGCCTCCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-54s1c1
Sequence:CCGGCGGCTCTATTGTGCACTCGGACTCGAGTCCGAGTGCACAATAGAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-1044s21c1
Sequence:CCGGCACACTCTACGGCAACGTGTTCTCGAGAACACGTTGCCGTAGAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-1296s1c1
Sequence:CCGGCGCGCAGGAGATCACCAACCTCTCGAGAGGTTGGTGATCTCCTGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-205s21c1
Sequence:CCGGTCTGTCAAGATGGTCCAGAGCCTCGAGGCTCTGGACCATCTTGACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-197s21c1
Sequence:CCGGACCCGTCCTCTGTCAAGATGGCTCGAGCCATCTTGACAGAGGACGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006236
POU3F3 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-647s1c1
Sequence:CCGGCGCCGCAGAGTCTGCTCTACTCTCGAGAGTAGAGCAGACTCTGCGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-213s1c1
Sequence:CCGGGATGGTCCAGAGCGACTTCATCTCGAGATGAAGTCGCTCTGGACCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-672s1c1
Sequence:CCGGGCCCGGAGGCTTCACGGTGAACTCGAGTTCACCGTGAAGCCTCCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-54s1c1
Sequence:CCGGCGGCTCTATTGTGCACTCGGACTCGAGTCCGAGTGCACAATAGAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-1044s21c1
Sequence:CCGGCACACTCTACGGCAACGTGTTCTCGAGAACACGTTGCCGTAGAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-1296s1c1
Sequence:CCGGCGCGCAGGAGATCACCAACCTCTCGAGAGGTTGGTGATCTCCTGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-205s21c1
Sequence:CCGGTCTGTCAAGATGGTCCAGAGCCTCGAGGCTCTGGACCATCTTGACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-197s21c1
Sequence:CCGGACCCGTCCTCTGTCAAGATGGCTCGAGCCATCTTGACAGAGGACGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006236
POU3F3 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-647s1c1
Sequence:CCGGCGCCGCAGAGTCTGCTCTACTCTCGAGAGTAGAGCAGACTCTGCGGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000005753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-213s1c1
Sequence:CCGGGATGGTCCAGAGCGACTTCATCTCGAGATGAAGTCGCTCTGGACCATCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-672s1c1
Sequence:CCGGGCCCGGAGGCTTCACGGTGAACTCGAGTTCACCGTGAAGCCTCCGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000005754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-54s1c1
Sequence:CCGGCGGCTCTATTGTGCACTCGGACTCGAGTCCGAGTGCACAATAGAGCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-1044s21c1
Sequence:CCGGCACACTCTACGGCAACGTGTTCTCGAGAACACGTTGCCGTAGAGTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000005755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006236.1-1296s1c1
Sequence:CCGGCGCGCAGGAGATCACCAACCTCTCGAGAGGTTGGTGATCTCCTGCGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-205s21c1
Sequence:CCGGTCTGTCAAGATGGTCCAGAGCCTCGAGGCTCTGGACCATCTTGACAGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006236.1-197s21c1
Sequence:CCGGACCCGTCCTCTGTCAAGATGGCTCGAGCCATCTTGACAGAGGACGGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???