EMAIL THIS PAGE TO A FRIEND

POU4F2

POU class 4 homeobox 2

156 Gene Product Result for
Synonyms: BRN3.2 BRN3B Brn-3b
UniProtKB ID: Q12837, B1PJR6, B2RC84, Q13883, Q14987
Gene ID:
Human(5458) Summary: The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]
Mouse(18997) POU domain, class 4, transcription factor 2
Rat(171355) POU class 4 homeobox 2
Zebrafish(402816) POU domain, class 4, transcription factor 2
domestic cat(101084025) POU class 4 homeobox 2
Horse(100062678) POU class 4 homeobox 2
dog(482637) POU class 4 homeobox 2
chicken(428735) POU domain, class 4, transcription factor 2
domestic guinea pig(100725872) POU class 4 homeobox 2
naked mole-rat(101701626) POU class 4 homeobox 2
cow(532453) POU class 4 homeobox 2
sheep(101108860) POU class 4 homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38501 Anti-POU4F2 antibody produced in rabbit affinity isolated antibody dog, bovine, horse, guinea pig, human
western blot pricing
AV31368 Anti-POU4F2 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder bovine, human, zebrafish, rat, chicken, mouse, canine
western blot pricing
SAB2101849 Anti-POU4F2 antibody produced in rabbit affinity isolated antibody rat, mouse, human, guinea pig, dog, rabbit, bovine, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004575 Rosetta Predictions human pricing
XM_001074669 Rosetta Predictions rat pricing
XM_344756 Rosetta Predictions rat pricing
NM_138944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087300 predicted 1220
2 SASI_Hs01_00087301 predicted 1505
3 SASI_Hs02_00337912 predicted 1697
4 SASI_Hs01_00087302 predicted 1163
5 SASI_Hs01_00087303 predicted 1649
6 SASI_Hs01_00087304 predicted 1321
7 SASI_Hs01_00087305 predicted 1146
8 SASI_Hs01_00087307 predicted 1760
9 SASI_Hs01_00087308 predicted 1551
10 SASI_Hs01_00087309 predicted 1597
11 SASI_Hs01_00087306 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346944 predicted 1835
2 SASI_Rn02_00346945 predicted 1799
3 SASI_Rn02_00346946 predicted 1637
4 SASI_Rn02_00346947 predicted 1220
5 SASI_Rn02_00346948 predicted 1967
6 SASI_Rn02_00346949 predicted 1470
7 SASI_Rn02_00346950 predicted 1864
8 SASI_Rn02_00346951 predicted 1824
9 SASI_Rn02_00346952 predicted 1866
10 SASI_Rn02_00346953 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397515 predicted 1967
2 SASI_Rn02_00397516 predicted 1826
3 SASI_Rn02_00397517 predicted 1714
4 SASI_Rn02_00397518 predicted 1949
5 SASI_Rn02_00397519 predicted 664
6 SASI_Rn02_00397520 predicted 1637
7 SASI_Rn02_00397521 predicted 1451
8 SASI_Rn02_00397522 predicted 1920
9 SASI_Rn02_00397523 predicted 1221
10 SASI_Rn02_00397524 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021309 predicted 1227
2 SASI_Mm01_00021310 predicted 1790
3 SASI_Mm02_00339836 predicted 1250
4 SASI_Mm01_00021311 predicted 668
5 SASI_Mm01_00021312 predicted 1473
6 SASI_Mm02_00339837 predicted 1583
7 SASI_Mm01_00021314 predicted 1644
8 SASI_Mm01_00021315 predicted 1946
9 SASI_Mm01_00021316 predicted 1836
10 SASI_Mm01_00021317 predicted 317
11 SASI_Mm01_00021313 predicted 1958
12 SASI_Mm01_00021318 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138944
POU4F2 MISSION shRNA Bacterial Glycerol Stock
POU class 4 homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1660s21c1
Sequence:CCGGGTGAACCGGTTTCGCAGTGAACTCGAGTTCACTGCGAAACCGGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1968s21c1
Sequence:CCGGATGCTTAATGTGATATGATAGCTCGAGCTATCATATCACATTAAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1561s21c1
Sequence:CCGGCCTTTCTACTTTGGCTATCAGCTCGAGCTGATAGCCAAAGTAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1442s1c1
Sequence:CCGGGAGGCAGAAACAGAAGAGAATCTCGAGATTCTCTTCTGTTTCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-977s1c1
Sequence:CCGGGCCCTCGCACATGGGCTGCATCTCGAGATGCAGCCCATGTGCGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1462s1c1
Sequence:CCGGTGAAATACTCTGCCGGCATTTCTCGAGAAATGCCGGCAGAGTATTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1253s1c1
Sequence:CCGGGCTCACTAAGCCGGAGCTCTTCTCGAGAAGAGCTCCGGCTTAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-315s1c1
Sequence:CCGGGAGCCCAAGTACTCGGCGCTACTCGAGTAGCGCCGAGTACTTGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138944
POU4F2 MISSION shRNA shRNA Plasmid DNA
POU class 4 homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1660s21c1
Sequence:CCGGGTGAACCGGTTTCGCAGTGAACTCGAGTTCACTGCGAAACCGGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1968s21c1
Sequence:CCGGATGCTTAATGTGATATGATAGCTCGAGCTATCATATCACATTAAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1561s21c1
Sequence:CCGGCCTTTCTACTTTGGCTATCAGCTCGAGCTGATAGCCAAAGTAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1442s1c1
Sequence:CCGGGAGGCAGAAACAGAAGAGAATCTCGAGATTCTCTTCTGTTTCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-977s1c1
Sequence:CCGGGCCCTCGCACATGGGCTGCATCTCGAGATGCAGCCCATGTGCGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1462s1c1
Sequence:CCGGTGAAATACTCTGCCGGCATTTCTCGAGAAATGCCGGCAGAGTATTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1253s1c1
Sequence:CCGGGCTCACTAAGCCGGAGCTCTTCTCGAGAAGAGCTCCGGCTTAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-315s1c1
Sequence:CCGGGAGCCCAAGTACTCGGCGCTACTCGAGTAGCGCCGAGTACTTGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138944
POU4F2 MISSION shRNA Lentiviral Transduction Particles
POU class 4 homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1660s21c1
Sequence:CCGGGTGAACCGGTTTCGCAGTGAACTCGAGTTCACTGCGAAACCGGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1968s21c1
Sequence:CCGGATGCTTAATGTGATATGATAGCTCGAGCTATCATATCACATTAAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138944.2-1561s21c1
Sequence:CCGGCCTTTCTACTTTGGCTATCAGCTCGAGCTGATAGCCAAAGTAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1442s1c1
Sequence:CCGGGAGGCAGAAACAGAAGAGAATCTCGAGATTCTCTTCTGTTTCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-977s1c1
Sequence:CCGGGCCCTCGCACATGGGCTGCATCTCGAGATGCAGCCCATGTGCGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1462s1c1
Sequence:CCGGTGAAATACTCTGCCGGCATTTCTCGAGAAATGCCGGCAGAGTATTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-1253s1c1
Sequence:CCGGGCTCACTAAGCCGGAGCTCTTCTCGAGAAGAGCTCCGGCTTAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138944.1-315s1c1
Sequence:CCGGGAGCCCAAGTACTCGGCGCTACTCGAGTAGCGCCGAGTACTTGGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004575
POU4F2 MISSION shRNA Bacterial Glycerol Stock
POU class 4 homeobox 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004575.2-307s21c1
Sequence:CCGGTGCACGTGGAGCCCAAGTACTCTCGAGAGTACTTGGGCTCCACGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004575.2-1468s21c1
Sequence:CCGGCCGGCATTTAGAAGACTCTTGCTCGAGCAAGAGTCTTCTAAATGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004575.2-1803s21c1
Sequence:CCGGCCACAAGAATGATCAAGTAAGCTCGAGCTTACTTGATCATTCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-1139s1c1
Sequence:CCGGCCACAATAATATGATCGCGCTCTCGAGAGCGCGATCATATTATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004575.1-2265s1c1
Sequence:CCGGCCTCCTATACTGTGTTCCTTTCTCGAGAAAGGAACACAGTATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-677s1c1
Sequence:CCGGCTCTTCTTCATCGGTGCCCATCTCGAGATGGGCACCGATGAAGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004575.2-1846s21c1
Sequence:CCGGATCACCCGTGTTCAAGTTTAACTCGAGTTAAACTTGAACACGGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-633s1c1
Sequence:CCGGGCCACCTACCACACTATGAATCTCGAGATTCATAGTGTGGTAGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-1287s1c1
Sequence:CCGGCGCTCGCTCGAAGCCTACTTTCTCGAGAAAGTAGGCTTCGAGCGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004575
POU4F2 MISSION shRNA shRNA Plasmid DNA
POU class 4 homeobox 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004575.2-307s21c1
Sequence:CCGGTGCACGTGGAGCCCAAGTACTCTCGAGAGTACTTGGGCTCCACGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004575.2-1468s21c1
Sequence:CCGGCCGGCATTTAGAAGACTCTTGCTCGAGCAAGAGTCTTCTAAATGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004575.2-1803s21c1
Sequence:CCGGCCACAAGAATGATCAAGTAAGCTCGAGCTTACTTGATCATTCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-1139s1c1
Sequence:CCGGCCACAATAATATGATCGCGCTCTCGAGAGCGCGATCATATTATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004575.1-2265s1c1
Sequence:CCGGCCTCCTATACTGTGTTCCTTTCTCGAGAAAGGAACACAGTATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-677s1c1
Sequence:CCGGCTCTTCTTCATCGGTGCCCATCTCGAGATGGGCACCGATGAAGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004575.2-1846s21c1
Sequence:CCGGATCACCCGTGTTCAAGTTTAACTCGAGTTAAACTTGAACACGGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-633s1c1
Sequence:CCGGGCCACCTACCACACTATGAATCTCGAGATTCATAGTGTGGTAGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-1287s1c1
Sequence:CCGGCGCTCGCTCGAAGCCTACTTTCTCGAGAAAGTAGGCTTCGAGCGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004575
POU4F2 MISSION shRNA Lentiviral Transduction Particles
POU class 4 homeobox 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004575.2-307s21c1
Sequence:CCGGTGCACGTGGAGCCCAAGTACTCTCGAGAGTACTTGGGCTCCACGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004575.2-1468s21c1
Sequence:CCGGCCGGCATTTAGAAGACTCTTGCTCGAGCAAGAGTCTTCTAAATGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004575.2-1803s21c1
Sequence:CCGGCCACAAGAATGATCAAGTAAGCTCGAGCTTACTTGATCATTCTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-1139s1c1
Sequence:CCGGCCACAATAATATGATCGCGCTCTCGAGAGCGCGATCATATTATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004575.1-2265s1c1
Sequence:CCGGCCTCCTATACTGTGTTCCTTTCTCGAGAAAGGAACACAGTATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-677s1c1
Sequence:CCGGCTCTTCTTCATCGGTGCCCATCTCGAGATGGGCACCGATGAAGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004575.2-1846s21c1
Sequence:CCGGATCACCCGTGTTCAAGTTTAACTCGAGTTAAACTTGAACACGGGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-633s1c1
Sequence:CCGGGCCACCTACCACACTATGAATCTCGAGATTCATAGTGTGGTAGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004575.1-1287s1c1
Sequence:CCGGCGCTCGCTCGAAGCCTACTTTCTCGAGAAAGTAGGCTTCGAGCGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)