EMAIL THIS PAGE TO A FRIEND

POU4F3

POU class 4 homeobox 3

48 Gene Product Result for
Synonyms: BRN3C DFNA15
UniProtKB ID: Q15319, O60557, Q2M3F8
Gene ID:
Human(5459) Summary: This gene encodes a member of the POU-domain family of transcription factors. POU-domain proteins have been observed to play important roles in control of cell identity in several systems. This protein is found in the retina and may play a role in determining or maintaining the identities of a small subset of visual system neurons. Defects in this gene are the cause of non-syndromic sensorineural deafness autosomal dominant type 15. [provided by RefSeq, Mar 2009]
Mouse(18998) POU domain, class 4, transcription factor 3
Rat(364855) POU class 4 homeobox 3
cow(538520) POU class 4 homeobox 3
sheep(101113146) POU class 4 homeobox 3
naked mole-rat(101699239) POU class 4 homeobox 3
domestic guinea pig(100713776) POU class 4 homeobox 3
Zebrafish(30534) POU domain, class 4, transcription factor 3
chicken(395521) POU class 4 homeobox 3
domestic cat(101083318) POU class 4 homeobox 3
dog(487200) POU class 4 homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002700 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002700 Rosetta Predictions human pricing
NM_001108889 Rosetta Predictions rat pricing
NM_138945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126034 predicted 694
2 SASI_Hs01_00126035 predicted 686
3 SASI_Hs01_00126036 predicted 357
4 SASI_Hs01_00126037 predicted 408
5 SASI_Hs01_00126038 predicted 208
6 SASI_Hs01_00126039 predicted 209
7 SASI_Hs01_00126040 predicted 679
8 SASI_Hs01_00126041 predicted 335
9 SASI_Hs01_00126042 predicted 540
10 SASI_Hs02_00334281 predicted 786
11 SASI_Hs01_00126043 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243085 predicted 696
2 SASI_Rn02_00243086 predicted 1371
3 SASI_Rn02_00243087 predicted 1491
4 SASI_Rn02_00243088 predicted 996
5 SASI_Rn02_00243089 predicted 314
6 SASI_Rn02_00243090 predicted 1439
7 SASI_Rn02_00243091 predicted 696
8 SASI_Rn02_00243092 predicted 474
9 SASI_Rn02_00243093 predicted 1326
10 SASI_Rn02_00243094 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073209 predicted 343
2 SASI_Mm02_00339838 predicted 689
3 SASI_Mm01_00073210 predicted 622
4 SASI_Mm01_00073211 predicted 683
5 SASI_Mm01_00073212 predicted 310
6 SASI_Mm01_00073213 predicted 476
7 SASI_Mm01_00073214 predicted 695
8 SASI_Mm01_00073215 predicted 677
9 SASI_Mm01_00073216 predicted 543
10 SASI_Mm02_00339839 predicted 341
11 SASI_Mm01_00073208 predicted 695
12 SASI_Mm01_00073217 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138945
POU4F3 MISSION shRNA Bacterial Glycerol Stock
POU class 4 homeobox 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-627s1c1
Sequence:CCGGCGCGGCTTTAGCCAATCTTAACTCGAGTTAAGATTGGCTAAAGCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-42s1c1
Sequence:CCGGCGTACTGCAAGAACCCAAATTCTCGAGAATTTGGGTTCTTGCAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-41s1c1
Sequence:CCGGCCGTACTGCAAGAACCCAAATCTCGAGATTTGGGTTCTTGCAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-696s1c1
Sequence:CCGGGTCTCTTACTCTGTCGCACAACTCGAGTTGTGCGACAGAGTAAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-350s1c1
Sequence:CCGGGCGACTTACTTGAGCACATCTCTCGAGAGATGTGCTCAAGTAAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138945
POU4F3 MISSION shRNA shRNA Plasmid DNA
POU class 4 homeobox 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-627s1c1
Sequence:CCGGCGCGGCTTTAGCCAATCTTAACTCGAGTTAAGATTGGCTAAAGCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-42s1c1
Sequence:CCGGCGTACTGCAAGAACCCAAATTCTCGAGAATTTGGGTTCTTGCAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-41s1c1
Sequence:CCGGCCGTACTGCAAGAACCCAAATCTCGAGATTTGGGTTCTTGCAGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-696s1c1
Sequence:CCGGGTCTCTTACTCTGTCGCACAACTCGAGTTGTGCGACAGAGTAAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-350s1c1
Sequence:CCGGGCGACTTACTTGAGCACATCTCTCGAGAGATGTGCTCAAGTAAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138945
POU4F3 MISSION shRNA Lentiviral Transduction Particles
POU class 4 homeobox 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-627s1c1
Sequence:CCGGCGCGGCTTTAGCCAATCTTAACTCGAGTTAAGATTGGCTAAAGCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-42s1c1
Sequence:CCGGCGTACTGCAAGAACCCAAATTCTCGAGAATTTGGGTTCTTGCAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-41s1c1
Sequence:CCGGCCGTACTGCAAGAACCCAAATCTCGAGATTTGGGTTCTTGCAGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-696s1c1
Sequence:CCGGGTCTCTTACTCTGTCGCACAACTCGAGTTGTGCGACAGAGTAAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138945.1-350s1c1
Sequence:CCGGGCGACTTACTTGAGCACATCTCTCGAGAGATGTGCTCAAGTAAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002700
POU4F3 MISSION shRNA Bacterial Glycerol Stock
POU class 4 homeobox 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-201s1c1
Sequence:CCGGCCACGGCAAGAACCATCCGTTCTCGAGAACGGATGGTTCTTGCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-627s1c1
Sequence:CCGGCGCGGCTCTGGCTAATCTCAACTCGAGTTGAGATTAGCCAGAGCCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-40s1c1
Sequence:CCGGCCGGTGCTGCAAGAACCCAAACTCGAGTTTGGGTTCTTGCAGCACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-774s1c1
Sequence:CCGGCTACCGAGAGAAGAACAGCAACTCGAGTTGCTGTTCTTCTCTCGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-115s1c1
Sequence:CCGGCCGCAGCTGCAGGGTAATATACTCGAGTATATTACCCTGCAGCTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-785s21c1
Sequence:CCGGGTCTCTCACTCTCTCGCACAACTCGAGTTGTGCGAGAGAGTGAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-982s21c1
Sequence:CCGGGTCCTTCATCTGAGAAGATCGCTCGAGCGATCTTCTCAGATGAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-226s21c1
Sequence:CCGGTTGGAAGCTTTGATGAGAGCCCTCGAGGGCTCTCATCAAAGCTTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002700
POU4F3 MISSION shRNA shRNA Plasmid DNA
POU class 4 homeobox 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-201s1c1
Sequence:CCGGCCACGGCAAGAACCATCCGTTCTCGAGAACGGATGGTTCTTGCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-627s1c1
Sequence:CCGGCGCGGCTCTGGCTAATCTCAACTCGAGTTGAGATTAGCCAGAGCCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-40s1c1
Sequence:CCGGCCGGTGCTGCAAGAACCCAAACTCGAGTTTGGGTTCTTGCAGCACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-774s1c1
Sequence:CCGGCTACCGAGAGAAGAACAGCAACTCGAGTTGCTGTTCTTCTCTCGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-115s1c1
Sequence:CCGGCCGCAGCTGCAGGGTAATATACTCGAGTATATTACCCTGCAGCTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-785s21c1
Sequence:CCGGGTCTCTCACTCTCTCGCACAACTCGAGTTGTGCGAGAGAGTGAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-982s21c1
Sequence:CCGGGTCCTTCATCTGAGAAGATCGCTCGAGCGATCTTCTCAGATGAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-226s21c1
Sequence:CCGGTTGGAAGCTTTGATGAGAGCCCTCGAGGGCTCTCATCAAAGCTTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002700
POU4F3 MISSION shRNA Lentiviral Transduction Particles
POU class 4 homeobox 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-201s1c1
Sequence:CCGGCCACGGCAAGAACCATCCGTTCTCGAGAACGGATGGTTCTTGCCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-627s1c1
Sequence:CCGGCGCGGCTCTGGCTAATCTCAACTCGAGTTGAGATTAGCCAGAGCCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-40s1c1
Sequence:CCGGCCGGTGCTGCAAGAACCCAAACTCGAGTTTGGGTTCTTGCAGCACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-774s1c1
Sequence:CCGGCTACCGAGAGAAGAACAGCAACTCGAGTTGCTGTTCTTCTCTCGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002700.1-115s1c1
Sequence:CCGGCCGCAGCTGCAGGGTAATATACTCGAGTATATTACCCTGCAGCTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-785s21c1
Sequence:CCGGGTCTCTCACTCTCTCGCACAACTCGAGTTGTGCGAGAGAGTGAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-982s21c1
Sequence:CCGGGTCCTTCATCTGAGAAGATCGCTCGAGCGATCTTCTCAGATGAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002700.2-226s21c1
Sequence:CCGGTTGGAAGCTTTGATGAGAGCCCTCGAGGGCTCTCATCAAAGCTTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)