EMAIL THIS PAGE TO A FRIEND

POU5F1

POU class 5 homeobox 1

102 Gene Product Result for
Synonyms: OCT3 OCT4 OTF-3 OTF3 OTF4 Oct-3 Oct-4
Gene ID:
Human(5460) Summary: This gene encodes a transcription factor containing a POU homeodomain. This transcription factor plays a role in embryonic development, especially during early embryogenesis, and it is necessary for embryonic stem cell pluripotency. A translocation of this gene with the Ewing's sarcoma gene, t(6;22)(p21;q12), has been linked to tumor formation. Alternative splicing, as well as usage of alternative translation initiation codons, results in multiple isoforms, one of which initiates at a non-AUG (CUG) start codon. Related pseudogenes have been identified on chromosomes 1, 3, 8, 10, and 12. [provided by RefSeq, Mar 2010]
Mouse(18999) POU domain, class 5, transcription factor 1
Rat(294562) POU class 5 homeobox 1
dog(481709) POU class 5 homeobox 1
domestic cat(100174788) POU class 5 homeobox 1
domestic guinea pig(100724951) POU class 5 homeobox 1
naked mole-rat(101722299) POU class 5 homeobox 1
Domestic Rabbit(100101567) POU class 5 homeobox 1
cow(282316) POU class 5 homeobox 1
sheep(100302349) POU class 5 homeobox 1
Goat(100861237) POU class 5 homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
O8389 Anti-Oct 3/4 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4502259 Anti-OCT3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1306212 ANTI-OCT3/4 (C279) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306163 ANTI-OCT4 (OCT3) (E125) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1306162 ANTI-OCT4 (OCT3)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2500713 Anti-OCT4/POU5F1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, rat
ELISA, western blot pricing
SAB1305592 ANTI-PHOSPHO-OCT4(S236) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
P0873 Anti-POU5F1 (Oct4) antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
P0056 Anti-POU5F1 (Oct4) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2501454 Anti-POU5F1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
AV100956 Anti-POU5F1 antibody produced in rabbit IgG fraction of antiserum goat, human
western blot pricing
SAB2101850 Anti-POU5F1 antibody produced in rabbit affinity isolated antibody dog, rabbit, bovine, sheep, mouse, human, goat, pig
western blot pricing
SAB3500316 Anti-POU5F1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2701958 Anti-POU5F1 antibody produced in rabbit human
flow cytometry, immunocytochemistry, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2701960 Anti-POU5F1 antibody produced in rabbit human, mouse
flow cytometry, immunocytochemistry, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2701972 Anti-POU5F1 antibody produced in rabbit human, mouse
flow cytometry, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5100006 Imprint® ANTI-POU5F1 (OCT4) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100005 Imprint® ChIP-Validated Monoclonal Anti-POU5F1 (Oct4) antibody produced in mouse clone PF-29, purified immunoglobulin human
ChIP, western blot pricing
SAB3300035 Monoclonal Anti-OCT4 antibody produced in mouse clone 9B7, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
P0082 Monoclonal Anti-POU5F1 (Oct4) antibody produced in mouse ~1.0 mg/mL, clone PF-29, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, western blot pricing
WH0005460M1 Monoclonal Anti-POU5F1 antibody produced in mouse clone 1D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404228 Monoclonal Anti-POU5F1, (C-terminal) antibody produced in mouse clone 4F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1616 Human OCT-4 ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0049 AQUA Peptide FEALQLSL[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002701 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002701 Rosetta Predictions human pricing
NM_203289 Rosetta Predictions human pricing
NM_001009178 Rosetta Predictions rat pricing
XM_579282 Rosetta Predictions rat pricing
NM_013633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193932 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224603 predicted 633
2 SASI_Hs01_00224604 predicted 829
3 SASI_Hs01_00224605 predicted 640
4 SASI_Hs02_00373200 predicted 985
5 SASI_Hs02_00373201 predicted 116
6 SASI_Hs02_00373202 predicted 1053
7 SASI_Hs02_00373203 predicted 1074
8 SASI_Hs02_00373204 predicted 982
9 SASI_Hs02_00373205 predicted 983
10 SASI_Hs02_00373206 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199495 predicted 542
2 SASI_Rn01_00055749 predicted 795
3 SASI_Rn01_00055750 predicted 790
4 SASI_Rn01_00055751 predicted 617
5 SASI_Rn01_00055752 predicted 835
6 SASI_Rn01_00055753 predicted 207
7 SASI_Rn01_00055755 predicted 679
8 SASI_Rn01_00055756 predicted 676
9 SASI_Rn01_00055757 predicted 671
10 SASI_Rn01_00055758 predicted 633
11 SASI_Rn01_00055754 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194586 predicted 801
2 SASI_Rn01_00194587 predicted 800
3 SASI_Rn01_00194588 predicted 622
4 SASI_Rn01_00194589 predicted 841
5 SASI_Rn01_00194590 predicted 215
6 SASI_Rn01_00194591 predicted 492
7 SASI_Rn01_00194592 predicted 678
8 SASI_Rn01_00194593 predicted 680
9 SASI_Rn01_00194594 predicted 674
10 SASI_Rn01_00194595 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091228 predicted 849
2 SASI_Mm01_00091229 predicted 837
3 SASI_Mm02_00322418 predicted 656
4 SASI_Mm01_00091231 predicted 802
5 SASI_Mm01_00091232 predicted 363
6 SASI_Mm01_00091233 predicted 734
7 SASI_Mm01_00091234 predicted 666
8 SASI_Mm01_00091235 predicted 1024
9 SASI_Mm02_00322419 predicted 923
10 SASI_Mm01_00091237 predicted 829
11 SASI_Mm01_00091230 predicted 397
12 SASI_Mm01_00091236 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013633
POU5F1 MISSION shRNA Bacterial Glycerol Stock
POU class 5 homeobox 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013633.2-1024s21c1
Sequence:CCGGCCACTTCACCACACTCTACTCCTCGAGGAGTAGAGTGTGGTGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-544s1c1
Sequence:CCGGCGTTCTCTTTGGAAAGGTGTTCTCGAGAACACCTTTCCAAAGAGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013633.2-305s21c1
Sequence:CCGGCAAGTTGGCGTGGAGACTTTGCTCGAGCAAAGTCTCCACGCCAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-659s1c1
Sequence:CCGGGCCGACAACAATGAGAACCTTCTCGAGAAGGTTCTCATTGTTGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-1144s1c1
Sequence:CCGGCAAGGGAGGTAGACAAGAGAACTCGAGTTCTCTTGTCTACCTCCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-796s1c1
Sequence:CCGGCCTACAGCAGATCACTCACATCTCGAGATGTGAGTGATCTGCTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-391s1c1
Sequence:CCGGCAATGCCGTGAAGTTGGAGAACTCGAGTTCTCCAACTTCACGGCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013633
POU5F1 MISSION shRNA shRNA Plasmid DNA
POU class 5 homeobox 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013633.2-1024s21c1
Sequence:CCGGCCACTTCACCACACTCTACTCCTCGAGGAGTAGAGTGTGGTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-544s1c1
Sequence:CCGGCGTTCTCTTTGGAAAGGTGTTCTCGAGAACACCTTTCCAAAGAGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013633.2-305s21c1
Sequence:CCGGCAAGTTGGCGTGGAGACTTTGCTCGAGCAAAGTCTCCACGCCAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-659s1c1
Sequence:CCGGGCCGACAACAATGAGAACCTTCTCGAGAAGGTTCTCATTGTTGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-1144s1c1
Sequence:CCGGCAAGGGAGGTAGACAAGAGAACTCGAGTTCTCTTGTCTACCTCCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-796s1c1
Sequence:CCGGCCTACAGCAGATCACTCACATCTCGAGATGTGAGTGATCTGCTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-391s1c1
Sequence:CCGGCAATGCCGTGAAGTTGGAGAACTCGAGTTCTCCAACTTCACGGCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013633
POU5F1 MISSION shRNA Lentiviral Transduction Particles
POU class 5 homeobox 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013633.2-1024s21c1
Sequence:CCGGCCACTTCACCACACTCTACTCCTCGAGGAGTAGAGTGTGGTGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-544s1c1
Sequence:CCGGCGTTCTCTTTGGAAAGGTGTTCTCGAGAACACCTTTCCAAAGAGAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013633.2-305s21c1
Sequence:CCGGCAAGTTGGCGTGGAGACTTTGCTCGAGCAAAGTCTCCACGCCAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-659s1c1
Sequence:CCGGGCCGACAACAATGAGAACCTTCTCGAGAAGGTTCTCATTGTTGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-1144s1c1
Sequence:CCGGCAAGGGAGGTAGACAAGAGAACTCGAGTTCTCTTGTCTACCTCCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-796s1c1
Sequence:CCGGCCTACAGCAGATCACTCACATCTCGAGATGTGAGTGATCTGCTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013633.1-391s1c1
Sequence:CCGGCAATGCCGTGAAGTTGGAGAACTCGAGTTCTCCAACTTCACGGCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002701
VALIDATED
POU5F1 MISSION shRNA Bacterial Glycerol Stock
POU class 5 homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-911s21c1
Sequence:CCGGAGCGATCAAGCAGCGACTATGCTCGAGCATAGTCGCTGCTTGATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-522s21c1
Sequence:CCGGGAGGATCACCCTGGGATATACCTCGAGGTATATCCCAGGGTGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-1114s21c1
Sequence:CCGGGGCTCTCCCATGCATTCAAACCTCGAGGTTTGAATGCATGGGAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-688s1c1
Sequence:CCGGACTATGCACAACGAGAGGATTCTCGAGAATCCTCTCGTTGTGCATAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-165s1c1
Sequence:CCGGGAGATTGATAACTGGTGTGTTCTCGAGAACACACCAGTTATCAATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002701.1-998s1c1
Sequence:CCGGTCATTCACTAAGGAAGGAATTCTCGAGAATTCCTTCCTTAGTGAATGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002701.1-797s1c1
Sequence:CCGGCCCTCACTTCACTGCACTGTACTCGAGTACAGTGCAGTGAAGTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-135s1c1
Sequence:CCGGCGTAGGTTCTTGAATCCCGAACTCGAGTTCGGGATTCAAGAACCTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-752s21c1
Sequence:CCGGAGCGAACCAGTATCGAGAACCCTCGAGGGTTCTCGATACTGGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002701.4-1224s21c1
Sequence:CCGGTTAAGTTCTTCATTCACTAAGCTCGAGCTTAGTGAATGAAGAACTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002701
VALIDATED
POU5F1 MISSION shRNA shRNA Plasmid DNA
POU class 5 homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-911s21c1
Sequence:CCGGAGCGATCAAGCAGCGACTATGCTCGAGCATAGTCGCTGCTTGATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-522s21c1
Sequence:CCGGGAGGATCACCCTGGGATATACCTCGAGGTATATCCCAGGGTGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-1114s21c1
Sequence:CCGGGGCTCTCCCATGCATTCAAACCTCGAGGTTTGAATGCATGGGAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-688s1c1
Sequence:CCGGACTATGCACAACGAGAGGATTCTCGAGAATCCTCTCGTTGTGCATAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-165s1c1
Sequence:CCGGGAGATTGATAACTGGTGTGTTCTCGAGAACACACCAGTTATCAATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002701.1-998s1c1
Sequence:CCGGTCATTCACTAAGGAAGGAATTCTCGAGAATTCCTTCCTTAGTGAATGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002701.1-797s1c1
Sequence:CCGGCCCTCACTTCACTGCACTGTACTCGAGTACAGTGCAGTGAAGTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-135s1c1
Sequence:CCGGCGTAGGTTCTTGAATCCCGAACTCGAGTTCGGGATTCAAGAACCTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-752s21c1
Sequence:CCGGAGCGAACCAGTATCGAGAACCCTCGAGGGTTCTCGATACTGGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002701.4-1224s21c1
Sequence:CCGGTTAAGTTCTTCATTCACTAAGCTCGAGCTTAGTGAATGAAGAACTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002701
VALIDATED
POU5F1 MISSION shRNA Lentiviral Transduction Particles
POU class 5 homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-911s21c1
Sequence:CCGGAGCGATCAAGCAGCGACTATGCTCGAGCATAGTCGCTGCTTGATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-522s21c1
Sequence:CCGGGAGGATCACCCTGGGATATACCTCGAGGTATATCCCAGGGTGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-1114s21c1
Sequence:CCGGGGCTCTCCCATGCATTCAAACCTCGAGGTTTGAATGCATGGGAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-688s1c1
Sequence:CCGGACTATGCACAACGAGAGGATTCTCGAGAATCCTCTCGTTGTGCATAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-165s1c1
Sequence:CCGGGAGATTGATAACTGGTGTGTTCTCGAGAACACACCAGTTATCAATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002701.1-998s1c1
Sequence:CCGGTCATTCACTAAGGAAGGAATTCTCGAGAATTCCTTCCTTAGTGAATGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002701.1-797s1c1
Sequence:CCGGCCCTCACTTCACTGCACTGTACTCGAGTACAGTGCAGTGAAGTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002701.1-135s1c1
Sequence:CCGGCGTAGGTTCTTGAATCCCGAACTCGAGTTCGGGATTCAAGAACCTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002701.4-752s21c1
Sequence:CCGGAGCGAACCAGTATCGAGAACCCTCGAGGGTTCTCGATACTGGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002701.4-1224s21c1
Sequence:CCGGTTAAGTTCTTCATTCACTAAGCTCGAGCTTAGTGAATGAAGAACTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)