EMAIL THIS PAGE TO A FRIEND

POU5F2

POU domain class 5, transcription factor 2

44 Gene Product Result for
Synonyms: SPRM-1
UniProtKB ID: Q8N7G0, Q15169, Q6MZL7, Q8N748
Gene ID:
Mouse(75507) POU domain class 5, transcription factor 2
Rat(680620) POU domain class 5, transcription factor 2
sheep(101122027) POU domain class 5, transcription factor 2
domestic guinea pig(100721759) POU domain class 5, transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_889570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_889570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_889570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153216 Rosetta Predictions human pricing
NM_001081751 Rosetta Predictions rat pricing
XM_889570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159833 predicted 550
2 SASI_Hs01_00159835 predicted 948
3 SASI_Hs01_00159836 predicted 384
4 SASI_Hs01_00159837 predicted 386
5 SASI_Hs01_00159838 predicted 488
6 SASI_Hs01_00159839 predicted 638
7 SASI_Hs01_00159840 predicted 685
8 SASI_Hs01_00159841 predicted 807
9 SASI_Hs01_00159842 predicted 550
10 SASI_Hs02_00367076 predicted 665
11 SASI_Hs01_00159834 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208639 predicted 443
2 SASI_Rn02_00208640 predicted 620
3 SASI_Rn02_00208641 predicted 542
4 SASI_Rn02_00208642 predicted 818
5 SASI_Rn02_00208643 predicted 347
6 SASI_Rn02_00208644 predicted 812
7 SASI_Rn02_00208645 predicted 690
8 SASI_Rn02_00208646 predicted 589
9 SASI_Rn02_00208647 predicted 344
10 SASI_Rn02_00208648 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229276 predicted 345
2 SASI_Mm01_00229277 predicted 1107
3 SASI_Mm01_00229278 predicted 597
4 SASI_Mm01_00229279 predicted 791
5 SASI_Mm01_00229280 predicted 655
6 SASI_Mm01_00229281 predicted 560
7 SASI_Mm01_00229282 predicted 1108
8 SASI_Mm01_00229283 predicted 1083
9 SASI_Mm01_00229284 predicted 1055
10 SASI_Mm01_00229285 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153216
POU5F2 MISSION shRNA Bacterial Glycerol Stock
POU domain class 5, transcription factor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-552s21c1
Sequence:CCGGAGCTAAGCGTCGCCAACATGTCTCGAGACATGTTGGCGACGCTTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-350s21c1
Sequence:CCGGTACATTGCCCTGCGGAGCATTCTCGAGAATGCTCCGCAGGGCAATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-834s21c1
Sequence:CCGGGCAGTCGACCAACCAATGATGCTCGAGCATCATTGGTTGGTCGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-386s1c1
Sequence:CCGGCCAGAGGACATCTCGGGCATACTCGAGTATGCCCGAGATGTCCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-811s1c1
Sequence:CCGGGTTCTATAACCGCAGCAAGATCTCGAGATCTTGCTGCGGTTATAGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-948s1c1
Sequence:CCGGCCCACTATACACGTCTCTACTCTCGAGAGTAGAGACGTGTATAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-618s1c1
Sequence:CCGGCAGAGAACCTTCTGGGCTTATCTCGAGATAAGCCCAGAAGGTTCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-798s1c1
Sequence:CCGGTGGTTCGAGTTTGGTTCTATACTCGAGTATAGAACCAAACTCGAACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153216
POU5F2 MISSION shRNA shRNA Plasmid DNA
POU domain class 5, transcription factor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-552s21c1
Sequence:CCGGAGCTAAGCGTCGCCAACATGTCTCGAGACATGTTGGCGACGCTTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-350s21c1
Sequence:CCGGTACATTGCCCTGCGGAGCATTCTCGAGAATGCTCCGCAGGGCAATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-834s21c1
Sequence:CCGGGCAGTCGACCAACCAATGATGCTCGAGCATCATTGGTTGGTCGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-386s1c1
Sequence:CCGGCCAGAGGACATCTCGGGCATACTCGAGTATGCCCGAGATGTCCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-811s1c1
Sequence:CCGGGTTCTATAACCGCAGCAAGATCTCGAGATCTTGCTGCGGTTATAGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-948s1c1
Sequence:CCGGCCCACTATACACGTCTCTACTCTCGAGAGTAGAGACGTGTATAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-618s1c1
Sequence:CCGGCAGAGAACCTTCTGGGCTTATCTCGAGATAAGCCCAGAAGGTTCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-798s1c1
Sequence:CCGGTGGTTCGAGTTTGGTTCTATACTCGAGTATAGAACCAAACTCGAACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153216
POU5F2 MISSION shRNA Lentiviral Transduction Particles
POU domain class 5, transcription factor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-552s21c1
Sequence:CCGGAGCTAAGCGTCGCCAACATGTCTCGAGACATGTTGGCGACGCTTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-350s21c1
Sequence:CCGGTACATTGCCCTGCGGAGCATTCTCGAGAATGCTCCGCAGGGCAATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153216.1-834s21c1
Sequence:CCGGGCAGTCGACCAACCAATGATGCTCGAGCATCATTGGTTGGTCGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-386s1c1
Sequence:CCGGCCAGAGGACATCTCGGGCATACTCGAGTATGCCCGAGATGTCCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-811s1c1
Sequence:CCGGGTTCTATAACCGCAGCAAGATCTCGAGATCTTGCTGCGGTTATAGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-948s1c1
Sequence:CCGGCCCACTATACACGTCTCTACTCTCGAGAGTAGAGACGTGTATAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-618s1c1
Sequence:CCGGCAGAGAACCTTCTGGGCTTATCTCGAGATAAGCCCAGAAGGTTCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153216.1-798s1c1
Sequence:CCGGTGGTTCGAGTTTGGTTCTATACTCGAGTATAGAACCAAACTCGAACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_889570
POU5F2 MISSION shRNA Bacterial Glycerol Stock
POU domain class 5, transcription factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-132s21c1
Sequence:CCGGGGCAGCCACAAGCAGATTAATCTCGAGATTAATCTGCTTGTGGCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-801s21c1
Sequence:CCGGCAGTTGGCCAACCAATGATACCTCGAGGTATCATTGGTTGGCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-324s21c1
Sequence:CCGGCTTGAGATACATGCCAAATTTCTCGAGAAATTTGGCATGTATCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-452s21c1
Sequence:CCGGTCGCTGTGGGAGCTATGTTTGCTCGAGCAAACATAGCTCCCACAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_889570.2-1217s21c1
Sequence:CCGGGCAATATCTTTATGGCTATAACTCGAGTTATAGCCATAAAGATATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_889570
POU5F2 MISSION shRNA shRNA Plasmid DNA
POU domain class 5, transcription factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-132s21c1
Sequence:CCGGGGCAGCCACAAGCAGATTAATCTCGAGATTAATCTGCTTGTGGCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-801s21c1
Sequence:CCGGCAGTTGGCCAACCAATGATACCTCGAGGTATCATTGGTTGGCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-324s21c1
Sequence:CCGGCTTGAGATACATGCCAAATTTCTCGAGAAATTTGGCATGTATCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-452s21c1
Sequence:CCGGTCGCTGTGGGAGCTATGTTTGCTCGAGCAAACATAGCTCCCACAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_889570.2-1217s21c1
Sequence:CCGGGCAATATCTTTATGGCTATAACTCGAGTTATAGCCATAAAGATATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_889570
POU5F2 MISSION shRNA Lentiviral Transduction Particles
POU domain class 5, transcription factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-132s21c1
Sequence:CCGGGGCAGCCACAAGCAGATTAATCTCGAGATTAATCTGCTTGTGGCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-801s21c1
Sequence:CCGGCAGTTGGCCAACCAATGATACCTCGAGGTATCATTGGTTGGCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-324s21c1
Sequence:CCGGCTTGAGATACATGCCAAATTTCTCGAGAAATTTGGCATGTATCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_889570.2-452s21c1
Sequence:CCGGTCGCTGTGGGAGCTATGTTTGCTCGAGCAAACATAGCTCCCACAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_889570.2-1217s21c1
Sequence:CCGGGCAATATCTTTATGGCTATAACTCGAGTTATAGCCATAAAGATATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)