EMAIL THIS PAGE TO A FRIEND

POU6F2

POU class 6 homeobox 2

47 Gene Product Result for
Synonyms: RPF-1 WT5 WTSL
Gene ID:
Human(11281) Summary: This gene encodes a member of the POU protein family characterized by the presence of a bipartite DNA binding domain, consisting of a POU-specific domain and a homeodomain, separated by a variable polylinker. The DNA binding domain may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner. The POU family members are transcriptional regulators, many of which are known to control cell type-specific differentiation pathways. This gene is a tumor suppressor involved in Wilms tumor (WT) predisposition. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(218030) POU domain, class 6, transcription factor 2
Rat(681092) POU domain, class 6, transcription factor 2
cow(517861) POU class 6 homeobox 2
sheep(101120407) POU class 6 homeobox 2
naked mole-rat(101707418) POU class 6 homeobox 2
domestic guinea pig(100719507) POU class 6 homeobox 2
chicken(420763) POU class 6 homeobox 2
domestic cat(101099283) POU class 6 homeobox 2
dog(483249) POU class 6 homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007252 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007252 Rosetta Predictions human pricing
NM_001101002 Rosetta Predictions rat pricing
NM_175006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073292 predicted 1674
2 SASI_Hs01_00073293 predicted 1973
3 SASI_Hs01_00073294 predicted 1962
4 SASI_Hs01_00073295 predicted 1072
5 SASI_Hs01_00073296 predicted 1117
6 SASI_Hs01_00073297 predicted 1926
7 SASI_Hs01_00073298 predicted 1898
8 SASI_Hs01_00073299 predicted 1810
9 SASI_Hs01_00073300 predicted 1804
10 SASI_Hs02_00343277 predicted 1749
11 SASI_Hs01_00073291 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211146 predicted 1498
2 SASI_Rn02_00211147 predicted 1491
3 SASI_Rn02_00211148 predicted 1341
4 SASI_Rn02_00211149 predicted 1413
5 SASI_Rn02_00211150 predicted 1488
6 SASI_Rn02_00211151 predicted 1647
7 SASI_Rn02_00211152 predicted 1266
8 SASI_Rn02_00211153 predicted 1554
9 SASI_Rn02_00211154 predicted 1548
10 SASI_Rn02_00211155 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345571 predicted 1294
2 SASI_Mm01_00140327 predicted 1574
3 SASI_Mm01_00140328 predicted 1362
4 SASI_Mm01_00140329 predicted 993
5 SASI_Mm01_00140330 predicted 2033
6 SASI_Mm01_00140331 predicted 1496
7 SASI_Mm01_00140332 predicted 1511
8 SASI_Mm01_00140333 predicted 1262
9 SASI_Mm01_00140334 predicted 1145
10 SASI_Mm01_00140335 predicted 360
11 SASI_Mm01_00140336 predicted 1743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175006
POU6F2 MISSION shRNA Bacterial Glycerol Stock
POU class 6 homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1000s21c1
Sequence:CCGGACCCTCTACAGCTGGTTAATACTCGAGTATTAACCAGCTGTAGAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1138s21c1
Sequence:CCGGATGCACAAGGACAGATTATTGCTCGAGCAATAATCTGTCCTTGTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1984s21c1
Sequence:CCGGAGATCCTCAATGCCCACTTTGCTCGAGCAAAGTGGGCATTGAGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175006.1-2219s1c1
Sequence:CCGGCGGAAGGAAGCATCACAGAAACTCGAGTTTCTGTGATGCTTCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-2092s1c1
Sequence:CCGGGCAATAAGAGACAAGCTCTAACTCGAGTTAGAGCTTGTCTCTTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-2114s1c1
Sequence:CCGGGAACACAATCAAACGCTTAAACTCGAGTTTAAGCGTTTGATTGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-1900s1c1
Sequence:CCGGGTATGCAGAATCTCACGGAATCTCGAGATTCCGTGAGATTCTGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-531s1c1
Sequence:CCGGGCGAATCTCACAAACATCCAACTCGAGTTGGATGTTTGTGAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175006
POU6F2 MISSION shRNA shRNA Plasmid DNA
POU class 6 homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1000s21c1
Sequence:CCGGACCCTCTACAGCTGGTTAATACTCGAGTATTAACCAGCTGTAGAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1138s21c1
Sequence:CCGGATGCACAAGGACAGATTATTGCTCGAGCAATAATCTGTCCTTGTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1984s21c1
Sequence:CCGGAGATCCTCAATGCCCACTTTGCTCGAGCAAAGTGGGCATTGAGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175006.1-2219s1c1
Sequence:CCGGCGGAAGGAAGCATCACAGAAACTCGAGTTTCTGTGATGCTTCCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-2092s1c1
Sequence:CCGGGCAATAAGAGACAAGCTCTAACTCGAGTTAGAGCTTGTCTCTTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-2114s1c1
Sequence:CCGGGAACACAATCAAACGCTTAAACTCGAGTTTAAGCGTTTGATTGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-1900s1c1
Sequence:CCGGGTATGCAGAATCTCACGGAATCTCGAGATTCCGTGAGATTCTGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-531s1c1
Sequence:CCGGGCGAATCTCACAAACATCCAACTCGAGTTGGATGTTTGTGAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175006
POU6F2 MISSION shRNA Lentiviral Transduction Particles
POU class 6 homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1000s21c1
Sequence:CCGGACCCTCTACAGCTGGTTAATACTCGAGTATTAACCAGCTGTAGAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1138s21c1
Sequence:CCGGATGCACAAGGACAGATTATTGCTCGAGCAATAATCTGTCCTTGTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175006.2-1984s21c1
Sequence:CCGGAGATCCTCAATGCCCACTTTGCTCGAGCAAAGTGGGCATTGAGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175006.1-2219s1c1
Sequence:CCGGCGGAAGGAAGCATCACAGAAACTCGAGTTTCTGTGATGCTTCCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-2092s1c1
Sequence:CCGGGCAATAAGAGACAAGCTCTAACTCGAGTTAGAGCTTGTCTCTTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-2114s1c1
Sequence:CCGGGAACACAATCAAACGCTTAAACTCGAGTTTAAGCGTTTGATTGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-1900s1c1
Sequence:CCGGGTATGCAGAATCTCACGGAATCTCGAGATTCCGTGAGATTCTGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175006.1-531s1c1
Sequence:CCGGGCGAATCTCACAAACATCCAACTCGAGTTGGATGTTTGTGAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007252
POU6F2 MISSION shRNA Bacterial Glycerol Stock
POU class 6 homeobox 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007252.3-1921s21c1
Sequence:CCGGTGCAGAACCTGACCGAGTTTACTCGAGTAAACTCGGTCAGGTTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007252.3-2084s21c1
Sequence:CCGGCCGAGAAGTAGTTAGAGTTTGCTCGAGCAAACTCTAACTACTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-1538s1c1
Sequence:CCGGCCGAGAATTTGCCAAAGCTTTCTCGAGAAAGCTTTGGCAAATTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-1959s1c1
Sequence:CCGGGCCCTGAAGAACACAATTAAACTCGAGTTTAATTGTGTTCTTCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-276s1c1
Sequence:CCGGGCTAGAGGAAACCCAGCATTACTCGAGTAATGCTGGGTTTCCTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-958s1c1
Sequence:CCGGCCAATCCTCTACAGCTGGTTACTCGAGTAACCAGCTGTAGAGGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007252
POU6F2 MISSION shRNA shRNA Plasmid DNA
POU class 6 homeobox 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007252.3-1921s21c1
Sequence:CCGGTGCAGAACCTGACCGAGTTTACTCGAGTAAACTCGGTCAGGTTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007252.3-2084s21c1
Sequence:CCGGCCGAGAAGTAGTTAGAGTTTGCTCGAGCAAACTCTAACTACTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-1538s1c1
Sequence:CCGGCCGAGAATTTGCCAAAGCTTTCTCGAGAAAGCTTTGGCAAATTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-1959s1c1
Sequence:CCGGGCCCTGAAGAACACAATTAAACTCGAGTTTAATTGTGTTCTTCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-276s1c1
Sequence:CCGGGCTAGAGGAAACCCAGCATTACTCGAGTAATGCTGGGTTTCCTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-958s1c1
Sequence:CCGGCCAATCCTCTACAGCTGGTTACTCGAGTAACCAGCTGTAGAGGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007252
POU6F2 MISSION shRNA Lentiviral Transduction Particles
POU class 6 homeobox 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007252.3-1921s21c1
Sequence:CCGGTGCAGAACCTGACCGAGTTTACTCGAGTAAACTCGGTCAGGTTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007252.3-2084s21c1
Sequence:CCGGCCGAGAAGTAGTTAGAGTTTGCTCGAGCAAACTCTAACTACTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-1538s1c1
Sequence:CCGGCCGAGAATTTGCCAAAGCTTTCTCGAGAAAGCTTTGGCAAATTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-1959s1c1
Sequence:CCGGGCCCTGAAGAACACAATTAAACTCGAGTTTAATTGTGTTCTTCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-276s1c1
Sequence:CCGGGCTAGAGGAAACCCAGCATTACTCGAGTAATGCTGGGTTTCCTCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007252.1-958s1c1
Sequence:CCGGCCAATCCTCTACAGCTGGTTACTCGAGTAACCAGCTGTAGAGGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)