EMAIL THIS PAGE TO A FRIEND

PP2D1

protein phosphatase 2C-like domain containing 1

76 Gene Product Result for
Synonyms: C3orf48
UniProtKB ID: A8MPX8, Q96LI7
Gene ID:
Mouse(110332) protein phosphatase 2C-like domain containing 1
Rat(316157) protein phosphatase 2C-like domain containing 1
dog(477053) protein phosphatase 2C-like domain containing 1
domestic cat(101080476) protein phosphatase 2C-like domain containing 1
naked mole-rat(101698583) protein phosphatase 2C-like domain containing 1
domestic guinea pig(100719570) protein phosphatase 2C-like domain containing 1
cow(532104) protein phosphatase 2C-like domain containing 1
sheep(101115506) protein phosphatase 2C-like domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144714 Rosetta Predictions human pricing
XM_001716709 Rosetta Predictions human pricing
XM_001717727 Rosetta Predictions human pricing
XM_001718092 Rosetta Predictions human pricing
NM_001134567 Rosetta Predictions rat pricing
NM_173449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132920 predicted 464
2 SASI_Hs01_00132921 predicted 392
3 SASI_Hs01_00132922 predicted 1129
4 SASI_Hs01_00132923 predicted 903
5 SASI_Hs01_00132924 predicted 1125
6 SASI_Hs01_00132925 predicted 724
7 SASI_Hs01_00132926 predicted 504
8 SASI_Hs01_00132927 predicted 880
9 SASI_Hs01_00132928 predicted 367
10 SASI_Hs01_00132929 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00412392 predicted 522
2 SASI_Hs02_00412393 predicted 966
3 SASI_Hs02_00412394 predicted 1056
4 SASI_Hs02_00412395 predicted 568
5 SASI_Hs02_00412396 predicted 706
6 SASI_Hs02_00412397 predicted 572
7 SASI_Hs02_00412398 predicted 1017
8 SASI_Hs02_00412399 predicted 629
9 SASI_Hs02_00412400 predicted 1065
10 SASI_Hs02_00412401 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419012 predicted 522
2 SASI_Hs02_00419013 predicted 961
3 SASI_Hs02_00419014 predicted 1052
4 SASI_Hs02_00419015 predicted 562
5 SASI_Hs02_00419016 predicted 706
6 SASI_Hs02_00419017 predicted 572
7 SASI_Hs02_00419018 predicted 1018
8 SASI_Hs02_00419019 predicted 624
9 SASI_Hs02_00419020 predicted 1064
10 SASI_Hs02_00419021 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00421628 predicted 517
2 SASI_Hs02_00421629 predicted 962
3 SASI_Hs02_00421630 predicted 1055
4 SASI_Hs02_00421631 predicted 563
5 SASI_Hs02_00421632 predicted 705
6 SASI_Hs02_00421633 predicted 570
7 SASI_Hs02_00421634 predicted 1022
8 SASI_Hs02_00421635 predicted 629
9 SASI_Hs02_00421636 predicted 1062
10 SASI_Hs02_00421637 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257159 predicted 2179
2 SASI_Rn02_00257160 predicted 340
3 SASI_Rn02_00257161 predicted 1237
4 SASI_Rn02_00257162 predicted 730
5 SASI_Rn02_00257163 predicted 1546
6 SASI_Rn02_00257164 predicted 1643
7 SASI_Rn02_00257165 predicted 2176
8 SASI_Rn02_00257166 predicted 610
9 SASI_Rn02_00257167 predicted 2048
10 SASI_Rn02_00257168 predicted 2187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345356 predicted 1351
2 SASI_Mm01_00122112 predicted 1302
3 SASI_Mm01_00122113 predicted 1845
4 SASI_Mm01_00122114 predicted 1948
5 SASI_Mm01_00122115 predicted 1561
6 SASI_Mm01_00122116 predicted 1532
7 SASI_Mm01_00122117 predicted 2130
8 SASI_Mm01_00122119 predicted 689
9 SASI_Mm01_00122120 predicted 1601
10 SASI_Mm02_00345357 predicted 1999
11 SASI_Mm01_00122118 predicted 2089
12 SASI_Mm01_00122121 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144714
PP2D1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2C-like domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-323s1c1
Sequence:CCGGAGACACACCAAACGCCATGAACTCGAGTTCATGGCGTTTGGTGTGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-950s1c1
Sequence:CCGGAGAGAAGAATACACAGCAATACTCGAGTATTGCTGTGTATTCTTCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-893s1c1
Sequence:CCGGTCTTACCAAATGACAACTGATCTCGAGATCAGTTGTCATTTGGTAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144714.x-1538s1c1
Sequence:CCGGACCATTAAACTCTGTCACCTACTCGAGTAGGTGACAGAGTTTAATGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-1016s1c1
Sequence:CCGGGAGTATGAGGACACACACAAACTCGAGTTTGTGTGTGTCCTCATACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144714
PP2D1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2C-like domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-323s1c1
Sequence:CCGGAGACACACCAAACGCCATGAACTCGAGTTCATGGCGTTTGGTGTGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-950s1c1
Sequence:CCGGAGAGAAGAATACACAGCAATACTCGAGTATTGCTGTGTATTCTTCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-893s1c1
Sequence:CCGGTCTTACCAAATGACAACTGATCTCGAGATCAGTTGTCATTTGGTAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144714.x-1538s1c1
Sequence:CCGGACCATTAAACTCTGTCACCTACTCGAGTAGGTGACAGAGTTTAATGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-1016s1c1
Sequence:CCGGGAGTATGAGGACACACACAAACTCGAGTTTGTGTGTGTCCTCATACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144714
PP2D1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2C-like domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-323s1c1
Sequence:CCGGAGACACACCAAACGCCATGAACTCGAGTTCATGGCGTTTGGTGTGTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-950s1c1
Sequence:CCGGAGAGAAGAATACACAGCAATACTCGAGTATTGCTGTGTATTCTTCTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-893s1c1
Sequence:CCGGTCTTACCAAATGACAACTGATCTCGAGATCAGTTGTCATTTGGTAAGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144714.x-1538s1c1
Sequence:CCGGACCATTAAACTCTGTCACCTACTCGAGTAGGTGACAGAGTTTAATGGTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144714.x-1016s1c1
Sequence:CCGGGAGTATGAGGACACACACAAACTCGAGTTTGTGTGTGTCCTCATACTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173449
PP2D1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2C-like domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1299s1c1
Sequence:CCGGCCACAGATCATATCTGGAGTACTCGAGTACTCCAGATATGATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1992s1c1
Sequence:CCGGGCTGAGTACATTGGCTGTGAACTCGAGTTCACAGCCAATGTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1556s1c1
Sequence:CCGGGCAAACAATCTCTGTCCCTATCTCGAGATAGGGACAGAGATTGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173449.1-2113s1c1
Sequence:CCGGCCAATGACCTAGAACAGCAAACTCGAGTTTGCTGTTCTAGGTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-863s1c1
Sequence:CCGGCGGTTTATTTGATAGCCATTACTCGAGTAATGGCTATCAAATAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173449
PP2D1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2C-like domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1299s1c1
Sequence:CCGGCCACAGATCATATCTGGAGTACTCGAGTACTCCAGATATGATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1992s1c1
Sequence:CCGGGCTGAGTACATTGGCTGTGAACTCGAGTTCACAGCCAATGTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1556s1c1
Sequence:CCGGGCAAACAATCTCTGTCCCTATCTCGAGATAGGGACAGAGATTGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173449.1-2113s1c1
Sequence:CCGGCCAATGACCTAGAACAGCAAACTCGAGTTTGCTGTTCTAGGTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-863s1c1
Sequence:CCGGCGGTTTATTTGATAGCCATTACTCGAGTAATGGCTATCAAATAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173449
PP2D1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2C-like domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1299s1c1
Sequence:CCGGCCACAGATCATATCTGGAGTACTCGAGTACTCCAGATATGATCTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1992s1c1
Sequence:CCGGGCTGAGTACATTGGCTGTGAACTCGAGTTCACAGCCAATGTACTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-1556s1c1
Sequence:CCGGGCAAACAATCTCTGTCCCTATCTCGAGATAGGGACAGAGATTGTTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173449.1-2113s1c1
Sequence:CCGGCCAATGACCTAGAACAGCAAACTCGAGTTTGCTGTTCTAGGTCATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173449.1-863s1c1
Sequence:CCGGCGGTTTATTTGATAGCCATTACTCGAGTAATGGCTATCAAATAAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???