EMAIL THIS PAGE TO A FRIEND

PPA1

pyrophosphatase (inorganic) 1

79 Gene Product Result for
Synonyms: IOPPP PP PP1 SID6-8061
UniProtKB ID: Q15181, Q2M348, Q5SQT7, Q6P7P4, Q9UQJ5, Q9Y5B1
Gene ID:
Human(5464) Summary: The protein encoded by this gene is a member of the inorganic pyrophosphatase (PPase) family. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Studies of a similar protein in bovine suggested a cytoplasmic localization of this enzyme. [provided by RefSeq, Jul 2008]
Mouse(67895) pyrophosphatase (inorganic) 1
Rat(294504) pyrophosphatase (inorganic) 1
Thale Cress(839579) inorganic pyrophosphatase
domestic cat(101099403) pyrophosphatase (inorganic) 1
dog(479238) pyrophosphatase (inorganic) 1
chicken(769424) pyrophosphatase (inorganic) 1
domestic guinea pig(100718967) pyrophosphatase (inorganic) 1
naked mole-rat(101714267) pyrophosphatase (inorganic) 1
cow(280701) pyrophosphatase (inorganic) 1
sheep(101105799) pyrophosphatase (inorganic) 1
Goat(100861078) pyrophosphatase (inorganic) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1645 Human PPA1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021129 Rosetta Predictions human pricing
XM_001055932 Rosetta Predictions rat pricing
XM_215416 Rosetta Predictions rat pricing
NM_026438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021831 predicted 454
2 SASI_Hs01_00021832 predicted 292
3 SASI_Hs01_00021833 predicted 567
4 SASI_Hs01_00021826 predicted 1071
5 SASI_Hs02_00354645 predicted 489
6 SASI_Hs02_00354646 predicted 559
7 SASI_Hs02_00354647 predicted 353
8 SASI_Hs02_00354648 predicted 515
9 SASI_Hs01_00021827 predicted 885
10 SASI_Hs01_00021828 predicted 244
11 SASI_Hs01_00021824 predicted 1059
12 SASI_Hs01_00021825 predicted 861
13 SASI_Hs01_00021829 predicted 831
14 SASI_Hs01_00021830 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281514 predicted 597
2 SASI_Rn02_00281515 predicted 579
3 SASI_Rn02_00281516 predicted 1037
4 SASI_Rn02_00281517 predicted 1136
5 SASI_Rn02_00281518 predicted 1051
6 SASI_Rn02_00281519 predicted 878
7 SASI_Rn02_00281520 predicted 997
8 SASI_Rn02_00281521 predicted 905
9 SASI_Rn02_00281522 predicted 452
10 SASI_Rn02_00281523 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375965 predicted 727
2 SASI_Rn02_00375966 predicted 714
3 SASI_Rn02_00375967 predicted 1163
4 SASI_Rn02_00375968 predicted 1263
5 SASI_Rn02_00375969 predicted 1175
6 SASI_Rn02_00375970 predicted 1014
7 SASI_Rn02_00375971 predicted 1120
8 SASI_Rn02_00375972 predicted 1031
9 SASI_Rn02_00375973 predicted 582
10 SASI_Rn02_00375974 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330265 predicted 351
2 SASI_Mm01_00077093 predicted 713
3 SASI_Mm01_00077094 predicted 457
4 SASI_Mm01_00077095 predicted 221
5 SASI_Mm01_00077096 predicted 767
6 SASI_Mm01_00077097 predicted 880
7 SASI_Mm01_00077098 predicted 679
8 SASI_Mm01_00077099 predicted 656
9 SASI_Mm01_00077100 predicted 932
10 SASI_Mm02_00330266 predicted 307
11 SASI_Mm01_00077091 predicted 362
12 SASI_Mm01_00077092 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026438
VALIDATED
PPA1 MISSION shRNA Bacterial Glycerol Stock
pyrophosphatase (inorganic) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-1024s1c1
Sequence:CCGGCCTGGAAGCATTAGATGCAAACTCGAGTTTGCATCTAATGCTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-187s1c1
Sequence:CCGGCAGTACATTTCTCCATTTCATCTCGAGATGAAATGGAGAAATGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-603s1c1
Sequence:CCGGCGCAGCCAATTATAAAGATATCTCGAGATATCTTTATAATTGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-777s1c1
Sequence:CCGGCCACGATTATTGGAAAGCATTCTCGAGAATGCTTTCCAATAATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-352s1c1
Sequence:CCGGGCGAATCTGTTCCCTTATAAACTCGAGTTTATAAGGGAACAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-986s21c1
Sequence:CCGGCTCTGGAACACGAGCTGTTACCTCGAGGTAACAGCTCGTGTTCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-186s21c1
Sequence:CCGGCAGTACATTTCTCCATTTCATCTCGAGATGAAATGGAGAAATGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-351s21c1
Sequence:CCGGGCGAATCTGTTCCCTTATAAACTCGAGTTTATAAGGGAACAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-455s21c1
Sequence:CCGGCAACGACCCAATCGATGTTTGCTCGAGCAAACATCGATTGGGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-669s21c1
Sequence:CCGGGATTGGTTTAGAAGGTATAAGCTCGAGCTTATACCTTCTAAACCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026438
VALIDATED
PPA1 MISSION shRNA shRNA Plasmid DNA
pyrophosphatase (inorganic) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-1024s1c1
Sequence:CCGGCCTGGAAGCATTAGATGCAAACTCGAGTTTGCATCTAATGCTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-187s1c1
Sequence:CCGGCAGTACATTTCTCCATTTCATCTCGAGATGAAATGGAGAAATGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-603s1c1
Sequence:CCGGCGCAGCCAATTATAAAGATATCTCGAGATATCTTTATAATTGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-777s1c1
Sequence:CCGGCCACGATTATTGGAAAGCATTCTCGAGAATGCTTTCCAATAATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-352s1c1
Sequence:CCGGGCGAATCTGTTCCCTTATAAACTCGAGTTTATAAGGGAACAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-986s21c1
Sequence:CCGGCTCTGGAACACGAGCTGTTACCTCGAGGTAACAGCTCGTGTTCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-186s21c1
Sequence:CCGGCAGTACATTTCTCCATTTCATCTCGAGATGAAATGGAGAAATGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-351s21c1
Sequence:CCGGGCGAATCTGTTCCCTTATAAACTCGAGTTTATAAGGGAACAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-455s21c1
Sequence:CCGGCAACGACCCAATCGATGTTTGCTCGAGCAAACATCGATTGGGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-669s21c1
Sequence:CCGGGATTGGTTTAGAAGGTATAAGCTCGAGCTTATACCTTCTAAACCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026438
VALIDATED
PPA1 MISSION shRNA Lentiviral Transduction Particles
pyrophosphatase (inorganic) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-1024s1c1
Sequence:CCGGCCTGGAAGCATTAGATGCAAACTCGAGTTTGCATCTAATGCTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-187s1c1
Sequence:CCGGCAGTACATTTCTCCATTTCATCTCGAGATGAAATGGAGAAATGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-603s1c1
Sequence:CCGGCGCAGCCAATTATAAAGATATCTCGAGATATCTTTATAATTGGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-777s1c1
Sequence:CCGGCCACGATTATTGGAAAGCATTCTCGAGAATGCTTTCCAATAATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026438.2-352s1c1
Sequence:CCGGGCGAATCTGTTCCCTTATAAACTCGAGTTTATAAGGGAACAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-986s21c1
Sequence:CCGGCTCTGGAACACGAGCTGTTACCTCGAGGTAACAGCTCGTGTTCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-186s21c1
Sequence:CCGGCAGTACATTTCTCCATTTCATCTCGAGATGAAATGGAGAAATGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-351s21c1
Sequence:CCGGGCGAATCTGTTCCCTTATAAACTCGAGTTTATAAGGGAACAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-455s21c1
Sequence:CCGGCAACGACCCAATCGATGTTTGCTCGAGCAAACATCGATTGGGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026438.4-669s21c1
Sequence:CCGGGATTGGTTTAGAAGGTATAAGCTCGAGCTTATACCTTCTAAACCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021129
VALIDATED
PPA1 MISSION shRNA Bacterial Glycerol Stock
pyrophosphatase (inorganic) 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-996s1c1
Sequence:CCGGCGTGTTCATCTGGATGTATTACTCGAGTAATACATCCAGATGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_021129.2-265s1c1
Sequence:CCGGGATTGCTACAAAGGACCCTTTCTCGAGAAAGGGTCCTTTGTAGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-912s1c1
Sequence:CCGGCAGTACCAACAGACGTGGATACTCGAGTATCCACGTCTGTTGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-498s1c1
Sequence:CCGGGCGTGAAAGTTCTAGGCATATCTCGAGATATGCCTAGAACTTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-332s1c1
Sequence:CCGGGCGAATTTGTTCCCGTATAAACTCGAGTTTATACGGGAACAAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-517s21c1
Sequence:CCGGGCGTGAAAGTTCTAGGCATATCTCGAGATATGCCTAGAACTTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-931s21c1
Sequence:CCGGCAGTACCAACAGACGTGGATACTCGAGTATCCACGTCTGTTGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021129.3-1015s21c1
Sequence:CCGGCGTGTTCATCTGGATGTATTACTCGAGTAATACATCCAGATGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-351s21c1
Sequence:CCGGGCGAATTTGTTCCCGTATAAACTCGAGTTTATACGGGAACAAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021129
VALIDATED
PPA1 MISSION shRNA shRNA Plasmid DNA
pyrophosphatase (inorganic) 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-996s1c1
Sequence:CCGGCGTGTTCATCTGGATGTATTACTCGAGTAATACATCCAGATGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_021129.2-265s1c1
Sequence:CCGGGATTGCTACAAAGGACCCTTTCTCGAGAAAGGGTCCTTTGTAGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-912s1c1
Sequence:CCGGCAGTACCAACAGACGTGGATACTCGAGTATCCACGTCTGTTGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-498s1c1
Sequence:CCGGGCGTGAAAGTTCTAGGCATATCTCGAGATATGCCTAGAACTTTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-332s1c1
Sequence:CCGGGCGAATTTGTTCCCGTATAAACTCGAGTTTATACGGGAACAAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-517s21c1
Sequence:CCGGGCGTGAAAGTTCTAGGCATATCTCGAGATATGCCTAGAACTTTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-931s21c1
Sequence:CCGGCAGTACCAACAGACGTGGATACTCGAGTATCCACGTCTGTTGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021129.3-1015s21c1
Sequence:CCGGCGTGTTCATCTGGATGTATTACTCGAGTAATACATCCAGATGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-351s21c1
Sequence:CCGGGCGAATTTGTTCCCGTATAAACTCGAGTTTATACGGGAACAAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021129
VALIDATED
PPA1 MISSION shRNA Lentiviral Transduction Particles
pyrophosphatase (inorganic) 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-996s1c1
Sequence:CCGGCGTGTTCATCTGGATGTATTACTCGAGTAATACATCCAGATGAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_021129.2-265s1c1
Sequence:CCGGGATTGCTACAAAGGACCCTTTCTCGAGAAAGGGTCCTTTGTAGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-912s1c1
Sequence:CCGGCAGTACCAACAGACGTGGATACTCGAGTATCCACGTCTGTTGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-498s1c1
Sequence:CCGGGCGTGAAAGTTCTAGGCATATCTCGAGATATGCCTAGAACTTTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021129.2-332s1c1
Sequence:CCGGGCGAATTTGTTCCCGTATAAACTCGAGTTTATACGGGAACAAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-517s21c1
Sequence:CCGGGCGTGAAAGTTCTAGGCATATCTCGAGATATGCCTAGAACTTTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-931s21c1
Sequence:CCGGCAGTACCAACAGACGTGGATACTCGAGTATCCACGTCTGTTGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021129.3-1015s21c1
Sequence:CCGGCGTGTTCATCTGGATGTATTACTCGAGTAATACATCCAGATGAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021129.3-351s21c1
Sequence:CCGGGCGAATTTGTTCCCGTATAAACTCGAGTTTATACGGGAACAAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)