EMAIL THIS PAGE TO A FRIEND

PPA2

pyrophosphatase (inorganic) 2

116 Gene Product Result for
Synonyms: SID6-306
Gene ID:
Human(27068) Summary: The protein encoded by this gene is localized to the mitochondrion, is highly similar to members of the inorganic pyrophosphatase (PPase) family, and contains the signature sequence essential for the catalytic activity of PPase. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(74776) pyrophosphatase (inorganic) 2
Rat(310856) pyrophosphatase (inorganic) 2
Thale Cress(816338) soluble inorganic pyrophosphatase 2
domestic cat(101085121) pyrophosphatase (inorganic) 2
dog(478500) pyrophosphatase (inorganic) 2
chicken(422539) pyrophosphatase (inorganic) 2
Zebrafish(402961) pyrophosphatase (inorganic) 2
cow(615820) pyrophosphatase (inorganic) 2
sheep(101104749) pyrophosphatase (inorganic) 2
naked mole-rat(101708993) pyrophosphatase (inorganic) 2
domestic guinea pig(100733683) pyrophosphatase (inorganic) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034191 Rosetta Predictions human pricing
NM_006903 Rosetta Predictions human pricing
NM_176866 Rosetta Predictions human pricing
NM_176867 Rosetta Predictions human pricing
NM_176869 Rosetta Predictions human pricing
XM_001075518 Rosetta Predictions rat pricing
XM_227690 Rosetta Predictions rat pricing
NM_146141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188371 predicted 946
2 SASI_Hs01_00188372 predicted 952
3 SASI_Hs01_00188373 predicted 816
4 SASI_Hs01_00188374 predicted 943
5 SASI_Hs01_00188375 predicted 829
6 SASI_Hs01_00188376 predicted 883
7 SASI_Hs01_00188377 predicted 857
8 SASI_Hs01_00188378 predicted 889
9 SASI_Hs01_00188379 predicted 877
10 SASI_Hs01_00188380 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187536 predicted 912
2 SASI_Hs01_00187537 predicted 918
3 SASI_Hs01_00187538 predicted 786
4 SASI_Hs01_00187539 predicted 910
5 SASI_Hs01_00187540 predicted 796
6 SASI_Hs01_00187541 predicted 848
7 SASI_Hs01_00187542 predicted 822
8 SASI_Hs01_00187543 predicted 856
9 SASI_Hs01_00187544 predicted 846
10 SASI_Hs01_00187545 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147822 predicted 690
2 SASI_Hs01_00147823 predicted 695
3 SASI_Hs01_00147824 predicted 566
4 SASI_Hs01_00147825 predicted 691
5 SASI_Hs01_00147826 predicted 585
6 SASI_Hs01_00147827 predicted 631
7 SASI_Hs01_00147828 predicted 600
8 SASI_Hs01_00147829 predicted 642
9 SASI_Hs01_00147830 predicted 625
10 SASI_Hs01_00147831 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011206 predicted 503
2 SASI_Hs01_00011207 predicted 504
3 SASI_Hs01_00011208 predicted 375
4 SASI_Hs01_00011209 predicted 495
5 SASI_Hs01_00011210 predicted 392
6 SASI_Hs01_00011211 predicted 435
7 SASI_Hs01_00011212 predicted 412
8 SASI_Hs01_00011213 predicted 450
9 SASI_Hs01_00011214 predicted 431
10 SASI_Hs01_00011215 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217566 predicted 1002
2 SASI_Hs01_00217567 predicted 1002
3 SASI_Hs01_00217568 predicted 870
4 SASI_Hs01_00217569 predicted 1001
5 SASI_Hs01_00217570 predicted 882
6 SASI_Hs01_00217571 predicted 930
7 SASI_Hs01_00217572 predicted 911
8 SASI_Hs01_00217573 predicted 943
9 SASI_Hs01_00217574 predicted 925
10 SASI_Hs01_00217575 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350033 predicted 271
2 SASI_Rn02_00350034 predicted 685
3 SASI_Rn02_00350035 predicted 548
4 SASI_Rn02_00350036 predicted 911
5 SASI_Rn02_00350037 predicted 608
6 SASI_Rn02_00350038 predicted 802
7 SASI_Rn02_00350039 predicted 560
8 SASI_Rn02_00350040 predicted 656
9 SASI_Rn02_00350041 predicted 822
10 SASI_Rn02_00350042 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384625 predicted 265
2 SASI_Rn02_00384626 predicted 681
3 SASI_Rn02_00384627 predicted 552
4 SASI_Rn02_00384628 predicted 911
5 SASI_Rn02_00384629 predicted 608
6 SASI_Rn02_00384630 predicted 804
7 SASI_Rn02_00384631 predicted 562
8 SASI_Rn02_00384632 predicted 656
9 SASI_Rn02_00384633 predicted 816
10 SASI_Rn02_00384634 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111814 predicted 942
2 SASI_Mm01_00111815 predicted 265
3 SASI_Mm01_00111816 predicted 272
4 SASI_Mm01_00111817 predicted 583
5 SASI_Mm01_00111818 predicted 710
6 SASI_Mm01_00111819 predicted 455
7 SASI_Mm01_00111820 predicted 352
8 SASI_Mm01_00111821 predicted 248
9 SASI_Mm01_00111822 predicted 824
10 SASI_Mm01_00111823 predicted 661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006903
PPA2 MISSION shRNA Bacterial Glycerol Stock
pyrophosphatase (inorganic) 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-164s1c1
Sequence:CCGGGCCTCTTCTTTAAGAATGTAACTCGAGTTACATTCTTAAAGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-854s1c1
Sequence:CCGGGATCATTAGTTGAATCGGTATCTCGAGATACCGATTCAACTAATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-253s1c1
Sequence:CCGGCCTATGAAGAAAGCACGAAATCTCGAGATTTCGTGCTTTCTTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-393s1c1
Sequence:CCGGGCTACGCTATGTGGCGAATATCTCGAGATATTCGCCACATAGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-856s21c1
Sequence:CCGGGATCATTAGTTGAATCGGTATCTCGAGATACCGATTCAACTAATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-571s1c1
Sequence:CCGGGCCTCAAAGTTTCATGATATTCTCGAGAATATCATGAAACTTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-395s21c1
Sequence:CCGGGCTACGCTATGTGGCGAATATCTCGAGATATTCGCCACATAGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-255s21c1
Sequence:CCGGCCTATGAAGAAAGCACGAAATCTCGAGATTTCGTGCTTTCTTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-573s21c1
Sequence:CCGGGCCTCAAAGTTTCATGATATTCTCGAGAATATCATGAAACTTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-166s21c1
Sequence:CCGGGCCTCTTCTTTAAGAATGTAACTCGAGTTACATTCTTAAAGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006903
PPA2 MISSION shRNA shRNA Plasmid DNA
pyrophosphatase (inorganic) 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-164s1c1
Sequence:CCGGGCCTCTTCTTTAAGAATGTAACTCGAGTTACATTCTTAAAGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-854s1c1
Sequence:CCGGGATCATTAGTTGAATCGGTATCTCGAGATACCGATTCAACTAATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-253s1c1
Sequence:CCGGCCTATGAAGAAAGCACGAAATCTCGAGATTTCGTGCTTTCTTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-393s1c1
Sequence:CCGGGCTACGCTATGTGGCGAATATCTCGAGATATTCGCCACATAGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-856s21c1
Sequence:CCGGGATCATTAGTTGAATCGGTATCTCGAGATACCGATTCAACTAATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-571s1c1
Sequence:CCGGGCCTCAAAGTTTCATGATATTCTCGAGAATATCATGAAACTTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-395s21c1
Sequence:CCGGGCTACGCTATGTGGCGAATATCTCGAGATATTCGCCACATAGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-255s21c1
Sequence:CCGGCCTATGAAGAAAGCACGAAATCTCGAGATTTCGTGCTTTCTTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-573s21c1
Sequence:CCGGGCCTCAAAGTTTCATGATATTCTCGAGAATATCATGAAACTTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-166s21c1
Sequence:CCGGGCCTCTTCTTTAAGAATGTAACTCGAGTTACATTCTTAAAGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006903
PPA2 MISSION shRNA Lentiviral Transduction Particles
pyrophosphatase (inorganic) 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-164s1c1
Sequence:CCGGGCCTCTTCTTTAAGAATGTAACTCGAGTTACATTCTTAAAGAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-854s1c1
Sequence:CCGGGATCATTAGTTGAATCGGTATCTCGAGATACCGATTCAACTAATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-253s1c1
Sequence:CCGGCCTATGAAGAAAGCACGAAATCTCGAGATTTCGTGCTTTCTTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-393s1c1
Sequence:CCGGGCTACGCTATGTGGCGAATATCTCGAGATATTCGCCACATAGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-856s21c1
Sequence:CCGGGATCATTAGTTGAATCGGTATCTCGAGATACCGATTCAACTAATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006903.3-571s1c1
Sequence:CCGGGCCTCAAAGTTTCATGATATTCTCGAGAATATCATGAAACTTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-395s21c1
Sequence:CCGGGCTACGCTATGTGGCGAATATCTCGAGATATTCGCCACATAGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-255s21c1
Sequence:CCGGCCTATGAAGAAAGCACGAAATCTCGAGATTTCGTGCTTTCTTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-573s21c1
Sequence:CCGGGCCTCAAAGTTTCATGATATTCTCGAGAATATCATGAAACTTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006903.4-166s21c1
Sequence:CCGGGCCTCTTCTTTAAGAATGTAACTCGAGTTACATTCTTAAAGAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146141
VALIDATED
PPA2 MISSION shRNA Bacterial Glycerol Stock
pyrophosphatase (inorganic) 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-573s1c1
Sequence:CCGGCCTTGGGACTTTGGCACTTATCTCGAGATAAGTGCCAAAGTCCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-516s1c1
Sequence:CCGGCGTCTGTGAAATAGGCTCAAACTCGAGTTTGAGCCTATTTCACAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-363s1c1
Sequence:CCGGGCAAGATATAAAGAACGGAAACTCGAGTTTCCGTTCTTTATATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-804s1c1
Sequence:CCGGCGACGTTATTAACTCTGCACACTCGAGTGTGCAGAGTTAATAACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-805s1c1
Sequence:CCGGGACGTTATTAACTCTGCACATCTCGAGATGTGCAGAGTTAATAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-363s21c1
Sequence:CCGGGCAAGATATAAAGAACGGAAACTCGAGTTTCCGTTCTTTATATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-573s21c1
Sequence:CCGGCCTTGGGACTTTGGCACTTATCTCGAGATAAGTGCCAAAGTCCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-804s21c1
Sequence:CCGGCGACGTTATTAACTCTGCACACTCGAGTGTGCAGAGTTAATAACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-516s21c1
Sequence:CCGGCGTCTGTGAAATAGGCTCAAACTCGAGTTTGAGCCTATTTCACAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146141
VALIDATED
PPA2 MISSION shRNA shRNA Plasmid DNA
pyrophosphatase (inorganic) 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-573s1c1
Sequence:CCGGCCTTGGGACTTTGGCACTTATCTCGAGATAAGTGCCAAAGTCCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-516s1c1
Sequence:CCGGCGTCTGTGAAATAGGCTCAAACTCGAGTTTGAGCCTATTTCACAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-363s1c1
Sequence:CCGGGCAAGATATAAAGAACGGAAACTCGAGTTTCCGTTCTTTATATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-804s1c1
Sequence:CCGGCGACGTTATTAACTCTGCACACTCGAGTGTGCAGAGTTAATAACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-805s1c1
Sequence:CCGGGACGTTATTAACTCTGCACATCTCGAGATGTGCAGAGTTAATAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-363s21c1
Sequence:CCGGGCAAGATATAAAGAACGGAAACTCGAGTTTCCGTTCTTTATATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-573s21c1
Sequence:CCGGCCTTGGGACTTTGGCACTTATCTCGAGATAAGTGCCAAAGTCCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-804s21c1
Sequence:CCGGCGACGTTATTAACTCTGCACACTCGAGTGTGCAGAGTTAATAACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-516s21c1
Sequence:CCGGCGTCTGTGAAATAGGCTCAAACTCGAGTTTGAGCCTATTTCACAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146141
VALIDATED
PPA2 MISSION shRNA Lentiviral Transduction Particles
pyrophosphatase (inorganic) 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-573s1c1
Sequence:CCGGCCTTGGGACTTTGGCACTTATCTCGAGATAAGTGCCAAAGTCCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-516s1c1
Sequence:CCGGCGTCTGTGAAATAGGCTCAAACTCGAGTTTGAGCCTATTTCACAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-363s1c1
Sequence:CCGGGCAAGATATAAAGAACGGAAACTCGAGTTTCCGTTCTTTATATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-804s1c1
Sequence:CCGGCGACGTTATTAACTCTGCACACTCGAGTGTGCAGAGTTAATAACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146141.1-805s1c1
Sequence:CCGGGACGTTATTAACTCTGCACATCTCGAGATGTGCAGAGTTAATAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-363s21c1
Sequence:CCGGGCAAGATATAAAGAACGGAAACTCGAGTTTCCGTTCTTTATATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-573s21c1
Sequence:CCGGCCTTGGGACTTTGGCACTTATCTCGAGATAAGTGCCAAAGTCCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-804s21c1
Sequence:CCGGCGACGTTATTAACTCTGCACACTCGAGTGTGCAGAGTTAATAACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146141.1-516s21c1
Sequence:CCGGCGTCTGTGAAATAGGCTCAAACTCGAGTTTGAGCCTATTTCACAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)