EMAIL THIS PAGE TO A FRIEND

PPAP2A

phosphatidic acid phosphatase type 2A

83 Gene Product Result for
Synonyms: LLP1a LPP1 PAP-2a PAP2
UniProtKB ID: O14494, B7ZKN8, G3XA95, O60457, O60463, Q17RZ4
Gene ID:
Human(8611) Summary: The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in synthesis of glycerolipids and in phospholipase D-mediated signal transduction. This enzyme is an integral membrane glycoprotein that plays a role in the hydrolysis and uptake of lipids from extracellular space. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Mouse(19012) phosphatidic acid phosphatase type 2A
Rat(64369) phosphatidic acid phosphatase type 2A
chicken(427138) phosphatidic acid phosphatase type 2A
dog(607962) phosphatidic acid phosphatase type 2A
domestic cat(101088547) phosphatidic acid phosphatase type 2A
cow(617172) phosphatidic acid phosphatase type 2A
sheep(101115312) phosphatidic acid phosphatase type 2A
naked mole-rat(101724889) phosphatidic acid phosphatase type 2A
domestic guinea pig(100135603) phosphatidic acid phosphatase type 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003711 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041711 MISSION® esiRNA esiRNA targeting mouse Ppap2a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003711 Rosetta Predictions human pricing
NM_176895 Rosetta Predictions human pricing
NM_022538 Rosetta Predictions rat pricing
NM_008247 Rosetta Predictions mouse pricing
NM_008903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078880 predicted 1140
2 SASI_Hs01_00078881 predicted 1198
3 SASI_Hs01_00078882 predicted 1223
4 SASI_Hs01_00078883 predicted 849
5 SASI_Hs01_00078884 predicted 1091
6 SASI_Hs02_00336131 predicted 858
7 SASI_Hs01_00078885 predicted 1245
8 SASI_Hs01_00078886 predicted 1223
9 SASI_Hs01_00078887 predicted 845
10 SASI_Hs01_00078888 predicted 932
11 SASI_Hs01_00078889 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190527 predicted 1137
2 SASI_Hs01_00190528 predicted 1203
3 SASI_Hs01_00190529 predicted 1229
4 SASI_Hs01_00190530 predicted 852
5 SASI_Hs01_00190531 predicted 1089
6 SASI_Hs02_00369292 predicted 863
7 SASI_Hs01_00190532 predicted 1255
8 SASI_Hs01_00190533 predicted 1226
9 SASI_Hs01_00190534 predicted 852
10 SASI_Hs01_00190535 predicted 936
11 SASI_Hs01_00190536 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033731 predicted 283
2 SASI_Rn01_00033732 predicted 439
3 SASI_Rn01_00033733 predicted 372
4 SASI_Rn01_00033734 predicted 529
5 SASI_Rn01_00033735 predicted 879
6 SASI_Rn01_00033736 predicted 352
7 SASI_Rn01_00033737 predicted 493
8 SASI_Rn01_00033738 predicted 209
9 SASI_Rn01_00033739 predicted 344
10 SASI_Rn01_00033740 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095754 predicted 841
2 SASI_Mm01_00095756 predicted 867
3 SASI_Mm01_00095758 predicted 952
4 SASI_Mm01_00095760 predicted 1000
5 SASI_Mm02_00313438 predicted 865
6 SASI_Mm01_00095761 predicted 892
7 SASI_Mm01_00095762 predicted 835
8 SASI_Mm01_00095763 predicted 1094
9 SASI_Mm02_00313439 predicted 845
10 SASI_Mm02_00313440 predicted 1018
11 SASI_Mm01_00095755 predicted 857
12 SASI_Mm01_00095757 predicted 936
13 SASI_Mm01_00095759 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049066 predicted 710
2 SASI_Mm01_00049068 predicted 732
3 SASI_Mm01_00049070 predicted 810
4 SASI_Mm01_00049072 predicted 859
5 SASI_Mm02_00314921 predicted 727
6 SASI_Mm01_00049073 predicted 760
7 SASI_Mm01_00049074 predicted 707
8 SASI_Mm01_00049075 predicted 964
9 SASI_Mm02_00314922 predicted 705
10 SASI_Mm02_00314923 predicted 887
11 SASI_Mm01_00049067 predicted 725
12 SASI_Mm01_00049069 predicted 793
13 SASI_Mm01_00049071 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008247
VALIDATED
PPAP2A MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-953s21c1
Sequence:CCGGGCATGCTGTTTGTCGCACTTTCTCGAGAAAGTGCGACAAACAGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-1135s21c1
Sequence:CCGGGCTATACTGGTTGCTTTGTATCTCGAGATACAAAGCAACCAGTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-804s21c1
Sequence:CCGGGCACTTCTTGGCTATCTGTAACTCGAGTTACAGATAGCCAAGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-450s21c1
Sequence:CCGGCCTCGATGTGATTTGCGTGTTCTCGAGAACACGCAAATCACATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-450s1c1
Sequence:CCGGCCTCGATGTGATTTGCGTGTTCTCGAGAACACGCAAATCACATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-1135s1c1
Sequence:CCGGGCTATACTGGTTGCTTTGTATCTCGAGATACAAAGCAACCAGTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-1167s1c1
Sequence:CCGGCTTCAAGGACACACATTCTTACTCGAGTAAGAATGTGTGTCCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008247.1-804s1c1
Sequence:CCGGGCACTTCTTGGCTATCTGTAACTCGAGTTACAGATAGCCAAGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008247
VALIDATED
PPAP2A MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-953s21c1
Sequence:CCGGGCATGCTGTTTGTCGCACTTTCTCGAGAAAGTGCGACAAACAGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-1135s21c1
Sequence:CCGGGCTATACTGGTTGCTTTGTATCTCGAGATACAAAGCAACCAGTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-804s21c1
Sequence:CCGGGCACTTCTTGGCTATCTGTAACTCGAGTTACAGATAGCCAAGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-450s21c1
Sequence:CCGGCCTCGATGTGATTTGCGTGTTCTCGAGAACACGCAAATCACATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-450s1c1
Sequence:CCGGCCTCGATGTGATTTGCGTGTTCTCGAGAACACGCAAATCACATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-1135s1c1
Sequence:CCGGGCTATACTGGTTGCTTTGTATCTCGAGATACAAAGCAACCAGTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-1167s1c1
Sequence:CCGGCTTCAAGGACACACATTCTTACTCGAGTAAGAATGTGTGTCCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008247.1-804s1c1
Sequence:CCGGGCACTTCTTGGCTATCTGTAACTCGAGTTACAGATAGCCAAGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008247
VALIDATED
PPAP2A MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-953s21c1
Sequence:CCGGGCATGCTGTTTGTCGCACTTTCTCGAGAAAGTGCGACAAACAGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-1135s21c1
Sequence:CCGGGCTATACTGGTTGCTTTGTATCTCGAGATACAAAGCAACCAGTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-804s21c1
Sequence:CCGGGCACTTCTTGGCTATCTGTAACTCGAGTTACAGATAGCCAAGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008247.2-450s21c1
Sequence:CCGGCCTCGATGTGATTTGCGTGTTCTCGAGAACACGCAAATCACATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-450s1c1
Sequence:CCGGCCTCGATGTGATTTGCGTGTTCTCGAGAACACGCAAATCACATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-1135s1c1
Sequence:CCGGGCTATACTGGTTGCTTTGTATCTCGAGATACAAAGCAACCAGTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008247.1-1167s1c1
Sequence:CCGGCTTCAAGGACACACATTCTTACTCGAGTAAGAATGTGTGTCCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008247.1-804s1c1
Sequence:CCGGGCACTTCTTGGCTATCTGTAACTCGAGTTACAGATAGCCAAGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003711
VALIDATED
PPAP2A MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-877s21c1
Sequence:CCGGGAGGGAATGCAGAAAGAGTTACTCGAGTAACTCTTTCTGCATTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-795s21c1
Sequence:CCGGCGGCCTCACTTCTTGGATGTTCTCGAGAACATCCAAGAAGTGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-1030s21c1
Sequence:CCGGGTCTTGTTGCCGTATCCATTTCTCGAGAAATGGATACGGCAACAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-1216s21c1
Sequence:CCGGCTCTGCATGAAACACCAACAACTCGAGTTGTTGGTGTTTCATGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003711.2-1383s21c1
Sequence:CCGGCTGCTGCTATGCCTCTTGGATCTCGAGATCCAAGAGGCATAGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-1383s1c1
Sequence:CCGGCTGCTGCTATGCCTCTTGGATCTCGAGATCCAAGAGGCATAGCAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-1030s1c1
Sequence:CCGGGTCTTGTTGCCGTATCCATTTCTCGAGAAATGGATACGGCAACAAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003711.x-1216s1c1
Sequence:CCGGCTCTGCATGAAACACCAACAACTCGAGTTGTTGGTGTTTCATGCAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-795s1c1
Sequence:CCGGCGGCCTCACTTCTTGGATGTTCTCGAGAACATCCAAGAAGTGAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-877s1c1
Sequence:CCGGGAGGGAATGCAGAAAGAGTTACTCGAGTAACTCTTTCTGCATTCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003711
VALIDATED
PPAP2A MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-877s21c1
Sequence:CCGGGAGGGAATGCAGAAAGAGTTACTCGAGTAACTCTTTCTGCATTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-795s21c1
Sequence:CCGGCGGCCTCACTTCTTGGATGTTCTCGAGAACATCCAAGAAGTGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-1030s21c1
Sequence:CCGGGTCTTGTTGCCGTATCCATTTCTCGAGAAATGGATACGGCAACAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-1216s21c1
Sequence:CCGGCTCTGCATGAAACACCAACAACTCGAGTTGTTGGTGTTTCATGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003711.2-1383s21c1
Sequence:CCGGCTGCTGCTATGCCTCTTGGATCTCGAGATCCAAGAGGCATAGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-1383s1c1
Sequence:CCGGCTGCTGCTATGCCTCTTGGATCTCGAGATCCAAGAGGCATAGCAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-1030s1c1
Sequence:CCGGGTCTTGTTGCCGTATCCATTTCTCGAGAAATGGATACGGCAACAAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003711.x-1216s1c1
Sequence:CCGGCTCTGCATGAAACACCAACAACTCGAGTTGTTGGTGTTTCATGCAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-795s1c1
Sequence:CCGGCGGCCTCACTTCTTGGATGTTCTCGAGAACATCCAAGAAGTGAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-877s1c1
Sequence:CCGGGAGGGAATGCAGAAAGAGTTACTCGAGTAACTCTTTCTGCATTCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003711
VALIDATED
PPAP2A MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-877s21c1
Sequence:CCGGGAGGGAATGCAGAAAGAGTTACTCGAGTAACTCTTTCTGCATTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-795s21c1
Sequence:CCGGCGGCCTCACTTCTTGGATGTTCTCGAGAACATCCAAGAAGTGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-1030s21c1
Sequence:CCGGGTCTTGTTGCCGTATCCATTTCTCGAGAAATGGATACGGCAACAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003711.2-1216s21c1
Sequence:CCGGCTCTGCATGAAACACCAACAACTCGAGTTGTTGGTGTTTCATGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003711.2-1383s21c1
Sequence:CCGGCTGCTGCTATGCCTCTTGGATCTCGAGATCCAAGAGGCATAGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-1383s1c1
Sequence:CCGGCTGCTGCTATGCCTCTTGGATCTCGAGATCCAAGAGGCATAGCAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-1030s1c1
Sequence:CCGGGTCTTGTTGCCGTATCCATTTCTCGAGAAATGGATACGGCAACAAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003711.x-1216s1c1
Sequence:CCGGCTCTGCATGAAACACCAACAACTCGAGTTGTTGGTGTTTCATGCAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-795s1c1
Sequence:CCGGCGGCCTCACTTCTTGGATGTTCTCGAGAACATCCAAGAAGTGAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003711.x-877s1c1
Sequence:CCGGGAGGGAATGCAGAAAGAGTTACTCGAGTAACTCTTTCTGCATTCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)