EMAIL THIS PAGE TO A FRIEND

PPAP2B

phosphatidic acid phosphatase type 2B

168 Gene Product Result for
Synonyms: Dri42 LPP3 PAP2B VCIP
UniProtKB ID: O14495, B2R651, D3DQ52, Q96GW0, Q99782
Gene ID:
Human(8613) Summary: The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is a membrane glycoprotein localized at the cell plasma membrane. It has been shown to actively hydrolyze extracellular lysophosphatidic acid and short-chain phosphatidic acid. The expression of this gene is found to be enhanced by epidermal growth factor in Hela cells. [provided by RefSeq, Mar 2010]
Mouse(67916) phosphatidic acid phosphatase type 2B
Rat(192270) phosphatidic acid phosphatase type 2B
domestic guinea pig(100713443) phosphatidic acid phosphatase type 2B
naked mole-rat(101699454) phosphatidic acid phosphatase type 2B
cow(617707) phosphatidic acid phosphatase type 2B
sheep(101102020) phosphatidic acid phosphatase type 2B
Zebrafish(557680) phosphatidic acid phosphatase type 2B
domestic cat(101095760) phosphatidic acid phosphatase type 2B
dog(479557) phosphatidic acid phosphatase type 2B
chicken(424666) phosphatidic acid phosphatase type 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003713 Rosetta Predictions human pricing
NM_177414 Rosetta Predictions human pricing
NM_138905 Rosetta Predictions rat pricing
NM_080555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127165 predicted 1286
2 SASI_Hs01_00127166 predicted 1864
3 SASI_Hs01_00127167 predicted 775
4 SASI_Hs01_00127168 predicted 1869
5 SASI_Hs01_00127169 predicted 1114
6 SASI_Hs01_00127173 predicted 1106
7 SASI_Hs02_00336133 predicted 930
8 SASI_Hs02_00336134 predicted 1943
9 SASI_Hs02_00336135 predicted 801
10 SASI_Hs02_00336136 predicted 1295
11 SASI_Hs01_00127170 predicted 1082
12 SASI_Hs01_00127171 predicted 1085
13 SASI_Hs01_00127172 predicted 1177
14 SASI_Hs01_00127174 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100351 predicted 1220
2 SASI_Hs01_00100352 predicted 1799
3 SASI_Hs01_00100353 predicted 713
4 SASI_Hs01_00100354 predicted 1802
5 SASI_Hs01_00100355 predicted 1044
6 SASI_Hs01_00100359 predicted 1043
7 SASI_Hs02_00369311 predicted 857
8 SASI_Hs02_00369312 predicted 1873
9 SASI_Hs02_00369313 predicted 734
10 SASI_Hs02_00369314 predicted 1225
11 SASI_Hs01_00100356 predicted 1012
12 SASI_Hs01_00100357 predicted 1023
13 SASI_Hs01_00100358 predicted 1110
14 SASI_Hs01_00100360 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110523 predicted 640
2 SASI_Rn01_00110524 predicted 776
3 SASI_Rn01_00110525 predicted 906
4 SASI_Rn01_00110526 predicted 588
5 SASI_Rn01_00110527 predicted 1749
6 SASI_Rn01_00110528 predicted 1131
7 SASI_Rn02_00268375 predicted 1118
8 SASI_Rn01_00110529 predicted 1032
9 SASI_Rn01_00110530 predicted 726
10 SASI_Rn01_00110531 predicted 1832
11 SASI_Rn01_00110522 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183816 predicted 964
2 SASI_Mm01_00183817 predicted 494
3 SASI_Mm01_00183818 predicted 808
4 SASI_Mm01_00183819 predicted 1103
5 SASI_Mm01_00183820 predicted 864
6 SASI_Mm01_00183821 predicted 641
7 SASI_Mm01_00183822 predicted 1182
8 SASI_Mm01_00183823 predicted 1203
9 SASI_Mm01_00183824 predicted 1233
10 SASI_Mm01_00183825 predicted 1213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080555
VALIDATED
PPAP2B MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080555.1-1201s1c1
Sequence:CCGGCGGGTATCTGACTACAAGCATCTCGAGATGCTTGTAGTCAGATACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-958s1c1
Sequence:CCGGCCTGATTTCAGTCAGATCAATCTCGAGATTGATCTGACTGAAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-984s1c1
Sequence:CCGGCGAGGGCTACATTCAGAACTACTCGAGTAGTTCTGAATGTAGCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-1383s1c1
Sequence:CCGGCAATCACCATAACATGGTGTACTCGAGTACACCATGTTATGGTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-692s1c1
Sequence:CCGGCCCTGAAAGTCAGTGAGACTACTCGAGTAGTCTCACTGACTTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080555.2-709s21c1
Sequence:CCGGGAAAGTCAGTGAGACTATAAACTCGAGTTTATAGTCTCACTGACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-973s21c1
Sequence:CCGGTGATTTCAGTCAGATCAATTGCTCGAGCAATTGATCTGACTGAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-638s21c1
Sequence:CCGGATCGAGACAAGCACCATTAAGCTCGAGCTTAATGGTGCTTGTCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-1214s21c1
Sequence:CCGGCGGGTATCTGACTACAAGCATCTCGAGATGCTTGTAGTCAGATACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-1875s21c1
Sequence:CCGGTCCGGGAATGGGCACACAATTCTCGAGAATTGTGTGCCCATTCCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080555
VALIDATED
PPAP2B MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080555.1-1201s1c1
Sequence:CCGGCGGGTATCTGACTACAAGCATCTCGAGATGCTTGTAGTCAGATACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-958s1c1
Sequence:CCGGCCTGATTTCAGTCAGATCAATCTCGAGATTGATCTGACTGAAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-984s1c1
Sequence:CCGGCGAGGGCTACATTCAGAACTACTCGAGTAGTTCTGAATGTAGCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-1383s1c1
Sequence:CCGGCAATCACCATAACATGGTGTACTCGAGTACACCATGTTATGGTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-692s1c1
Sequence:CCGGCCCTGAAAGTCAGTGAGACTACTCGAGTAGTCTCACTGACTTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080555.2-709s21c1
Sequence:CCGGGAAAGTCAGTGAGACTATAAACTCGAGTTTATAGTCTCACTGACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-973s21c1
Sequence:CCGGTGATTTCAGTCAGATCAATTGCTCGAGCAATTGATCTGACTGAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-638s21c1
Sequence:CCGGATCGAGACAAGCACCATTAAGCTCGAGCTTAATGGTGCTTGTCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-1214s21c1
Sequence:CCGGCGGGTATCTGACTACAAGCATCTCGAGATGCTTGTAGTCAGATACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-1875s21c1
Sequence:CCGGTCCGGGAATGGGCACACAATTCTCGAGAATTGTGTGCCCATTCCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080555
VALIDATED
PPAP2B MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080555.1-1201s1c1
Sequence:CCGGCGGGTATCTGACTACAAGCATCTCGAGATGCTTGTAGTCAGATACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-958s1c1
Sequence:CCGGCCTGATTTCAGTCAGATCAATCTCGAGATTGATCTGACTGAAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-984s1c1
Sequence:CCGGCGAGGGCTACATTCAGAACTACTCGAGTAGTTCTGAATGTAGCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-1383s1c1
Sequence:CCGGCAATCACCATAACATGGTGTACTCGAGTACACCATGTTATGGTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080555.1-692s1c1
Sequence:CCGGCCCTGAAAGTCAGTGAGACTACTCGAGTAGTCTCACTGACTTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080555.2-709s21c1
Sequence:CCGGGAAAGTCAGTGAGACTATAAACTCGAGTTTATAGTCTCACTGACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-973s21c1
Sequence:CCGGTGATTTCAGTCAGATCAATTGCTCGAGCAATTGATCTGACTGAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-638s21c1
Sequence:CCGGATCGAGACAAGCACCATTAAGCTCGAGCTTAATGGTGCTTGTCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-1214s21c1
Sequence:CCGGCGGGTATCTGACTACAAGCATCTCGAGATGCTTGTAGTCAGATACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080555.2-1875s21c1
Sequence:CCGGTCCGGGAATGGGCACACAATTCTCGAGAATTGTGTGCCCATTCCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003713
VALIDATED
PPAP2B MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-1466s1c1
Sequence:CCGGGACATTATTGACAGGAACAATCTCGAGATTGTTCCTGTCAATAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-1057s1c1
Sequence:CCGGCCCTGATTTCAGCCAGATCAACTCGAGTTGATCTGGCTGAAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003713.3-886s1c1
Sequence:CCGGCCGGATCTATTACCTGAAGAACTCGAGTTCTTCAGGTAATAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003713.3-1185s1c1
Sequence:CCGGCTATGCTGTATTTGGTGCTATCTCGAGATAGCACCAAATACAGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-717s1c1
Sequence:CCGGCCTTCCTCATCATCGAGACAACTCGAGTTGTCTCGATGATGAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003713.3-1867s21c1
Sequence:CCGGGCAGCACATGATGCCAGAAATCTCGAGATTTCTGGCATCATGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003713.3-1328s21c1
Sequence:CCGGAGTGATGTTCTGGCAGGATTTCTCGAGAAATCCTGCCAGAACATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003713.3-850s21c1
Sequence:CCGGCATTGCCATCCTCGCGATCATCTCGAGATGATCGCGAGGATGGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003713.3-1720s21c1
Sequence:CCGGCTGGATGTGCAATTGGTTTAACTCGAGTTAAACCAATTGCACATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003713.3-1391s21c1
Sequence:CCGGTCTGACCTCTTCAAGACTAAGCTCGAGCTTAGTCTTGAAGAGGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003713
VALIDATED
PPAP2B MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-1466s1c1
Sequence:CCGGGACATTATTGACAGGAACAATCTCGAGATTGTTCCTGTCAATAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-1057s1c1
Sequence:CCGGCCCTGATTTCAGCCAGATCAACTCGAGTTGATCTGGCTGAAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003713.3-886s1c1
Sequence:CCGGCCGGATCTATTACCTGAAGAACTCGAGTTCTTCAGGTAATAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003713.3-1185s1c1
Sequence:CCGGCTATGCTGTATTTGGTGCTATCTCGAGATAGCACCAAATACAGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-717s1c1
Sequence:CCGGCCTTCCTCATCATCGAGACAACTCGAGTTGTCTCGATGATGAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003713.3-1867s21c1
Sequence:CCGGGCAGCACATGATGCCAGAAATCTCGAGATTTCTGGCATCATGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003713.3-1328s21c1
Sequence:CCGGAGTGATGTTCTGGCAGGATTTCTCGAGAAATCCTGCCAGAACATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003713.3-850s21c1
Sequence:CCGGCATTGCCATCCTCGCGATCATCTCGAGATGATCGCGAGGATGGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003713.3-1720s21c1
Sequence:CCGGCTGGATGTGCAATTGGTTTAACTCGAGTTAAACCAATTGCACATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003713.3-1391s21c1
Sequence:CCGGTCTGACCTCTTCAAGACTAAGCTCGAGCTTAGTCTTGAAGAGGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003713
VALIDATED
PPAP2B MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-1466s1c1
Sequence:CCGGGACATTATTGACAGGAACAATCTCGAGATTGTTCCTGTCAATAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-1057s1c1
Sequence:CCGGCCCTGATTTCAGCCAGATCAACTCGAGTTGATCTGGCTGAAATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003713.3-886s1c1
Sequence:CCGGCCGGATCTATTACCTGAAGAACTCGAGTTCTTCAGGTAATAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003713.3-1185s1c1
Sequence:CCGGCTATGCTGTATTTGGTGCTATCTCGAGATAGCACCAAATACAGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003713.3-717s1c1
Sequence:CCGGCCTTCCTCATCATCGAGACAACTCGAGTTGTCTCGATGATGAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003713.3-1867s21c1
Sequence:CCGGGCAGCACATGATGCCAGAAATCTCGAGATTTCTGGCATCATGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003713.3-1328s21c1
Sequence:CCGGAGTGATGTTCTGGCAGGATTTCTCGAGAAATCCTGCCAGAACATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003713.3-850s21c1
Sequence:CCGGCATTGCCATCCTCGCGATCATCTCGAGATGATCGCGAGGATGGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003713.3-1720s21c1
Sequence:CCGGCTGGATGTGCAATTGGTTTAACTCGAGTTAAACCAATTGCACATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003713.3-1391s21c1
Sequence:CCGGTCTGACCTCTTCAAGACTAAGCTCGAGCTTAGTCTTGAAGAGGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)