EMAIL THIS PAGE TO A FRIEND

PPAP2C

phosphatidic acid phosphatase type 2C

84 Gene Product Result for
Synonyms: LPP2 PAP-2c PAP2-g
UniProtKB ID: O43688, A6NLV0, E9PAY8
Gene ID:
Human(8612) Summary: The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(50784) phosphatidic acid phosphatase type 2C
Rat(246115) phosphatidic acid phosphatase type 2c
Zebrafish(335485) phosphatidic acid phosphatase type 2C
dog(612442) phosphatidic acid phosphatase type 2C
domestic cat(101088986) phosphatidic acid phosphatase type 2C
cow(504545) phosphatidic acid phosphatase type 2C
sheep(101106938) phosphatidic acid phosphatase type 2C
naked mole-rat(101725640) phosphatidic acid phosphatase type 2C
domestic guinea pig(100734582) phosphatidic acid phosphatase type 2C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003712 siRNAs that have been validated in the lab human pricing
NM_177526 siRNAs that have been validated in the lab human pricing
NM_177543 siRNAs that have been validated in the lab human pricing
NM_139252 Rosetta Predictions rat pricing
NM_015817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003712 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209840 validated 592
2 SASI_Hs02_00336132 predicted 426
3 SASI_Hs01_00209841 predicted 365
4 SASI_Hs01_00209842 predicted 515
5 SASI_Hs01_00209843 predicted 427
6 SASI_Hs01_00209844 predicted 810
7 SASI_Hs01_00209845 predicted 765
8 SASI_Hs01_00209846 predicted 502
9 SASI_Hs01_00209848 predicted 616
10 SASI_Hs01_00209849 predicted 621
11 SASI_Hs01_00209847 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177526 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064910 validated 553
2 SASI_Hs02_00369362 predicted 388
3 SASI_Hs01_00064911 predicted 321
4 SASI_Hs01_00064912 predicted 475
5 SASI_Hs01_00064913 predicted 388
6 SASI_Hs01_00064914 predicted 766
7 SASI_Hs01_00064915 predicted 723
8 SASI_Hs01_00064916 predicted 463
9 SASI_Hs01_00064918 predicted 573
10 SASI_Hs01_00064919 predicted 583
11 SASI_Hs01_00064917 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177543 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026931 validated 665
2 SASI_Hs02_00369397 predicted 496
3 SASI_Hs01_00026932 predicted 425
4 SASI_Hs01_00026933 predicted 583
5 SASI_Hs01_00026934 predicted 498
6 SASI_Hs01_00026935 predicted 877
7 SASI_Hs01_00026936 predicted 828
8 SASI_Hs01_00026937 predicted 569
9 SASI_Hs01_00026939 predicted 686
10 SASI_Hs01_00026940 predicted 684
11 SASI_Hs01_00026938 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108736 predicted 865
2 SASI_Rn01_00108737 predicted 1302
3 SASI_Rn01_00108738 predicted 485
4 SASI_Rn01_00108739 predicted 665
5 SASI_Rn01_00108740 predicted 423
6 SASI_Rn01_00108741 predicted 717
7 SASI_Rn01_00108742 predicted 1245
8 SASI_Rn01_00108743 predicted 276
9 SASI_Rn01_00108744 predicted 373
10 SASI_Rn01_00108745 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091524 predicted 361
2 SASI_Mm02_00323214 predicted 1138
3 SASI_Mm02_00323215 predicted 486
4 SASI_Mm02_00323216 predicted 1396
5 SASI_Mm02_00323217 predicted 303
6 SASI_Mm01_00091527 predicted 629
7 SASI_Mm01_00091528 predicted 218
8 SASI_Mm02_00323218 predicted 343
9 SASI_Mm01_00091531 predicted 627
10 SASI_Mm02_00323219 predicted 1028
11 SASI_Mm01_00091525 predicted 1322
12 SASI_Mm01_00091526 predicted 1314
13 SASI_Mm01_00091529 predicted 1338
14 SASI_Mm01_00091530 predicted 1268
15 SASI_Mm01_00091532 predicted 1293
16 SASI_Mm01_00091533 predicted 1295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003712
VALIDATED
PPAP2C MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2C
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-366s21c1
Sequence:GTACCGGCAACTACGTGGCTGCTGTATACTCGAGTATACAGCAGCCACGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-165s21c1
Sequence:CCGGCGCTATCCTGACGCTGGTGAACTCGAGTTCACCAGCGTCAGGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-922s21c1
Sequence:CCGGGAGGCTGACCACAACCACTATCTCGAGATAGTGGTTGTGGTCAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003712.2-1225s21c1
Sequence:CCGGGAAGGGACCGAGAGATCAGATCTCGAGATCTGATCTCTCGGTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-824s21c1
Sequence:GTACCGGACATCTCAGACTTCTTCAAAGCTCGAGCTTTGAAGAAGTCTGAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-165s1c1
Sequence:CCGGCGCTATCCTGACGCTGGTGAACTCGAGTTCACCAGCGTCAGGATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-329s21c1
Sequence:CCGGTGTACACAGACCGGCTCTATTCTCGAGAATAGAGCCGGTCTGTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-440s21c1
Sequence:GTACCGGACCTGGCCAAGTACATGATTGCTCGAGCAATCATGTACTTGGCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-922s1c1
Sequence:CCGGGAGGCTGACCACAACCACTATCTCGAGATAGTGGTTGTGGTCAGCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-1225s1c1
Sequence:CCGGGAAGGGACCGAGAGATCAGATCTCGAGATCTGATCTCTCGGTCCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-342s1c1
Sequence:CCGGGCTCTATTCTCGCTCGGACTTCTCGAGAAGTCCGAGCGAGAATAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003712
VALIDATED
PPAP2C MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2C
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-366s21c1
Sequence:GTACCGGCAACTACGTGGCTGCTGTATACTCGAGTATACAGCAGCCACGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-165s21c1
Sequence:CCGGCGCTATCCTGACGCTGGTGAACTCGAGTTCACCAGCGTCAGGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-922s21c1
Sequence:CCGGGAGGCTGACCACAACCACTATCTCGAGATAGTGGTTGTGGTCAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003712.2-1225s21c1
Sequence:CCGGGAAGGGACCGAGAGATCAGATCTCGAGATCTGATCTCTCGGTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-824s21c1
Sequence:GTACCGGACATCTCAGACTTCTTCAAAGCTCGAGCTTTGAAGAAGTCTGAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-165s1c1
Sequence:CCGGCGCTATCCTGACGCTGGTGAACTCGAGTTCACCAGCGTCAGGATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-329s21c1
Sequence:CCGGTGTACACAGACCGGCTCTATTCTCGAGAATAGAGCCGGTCTGTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-440s21c1
Sequence:GTACCGGACCTGGCCAAGTACATGATTGCTCGAGCAATCATGTACTTGGCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-922s1c1
Sequence:CCGGGAGGCTGACCACAACCACTATCTCGAGATAGTGGTTGTGGTCAGCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-1225s1c1
Sequence:CCGGGAAGGGACCGAGAGATCAGATCTCGAGATCTGATCTCTCGGTCCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-342s1c1
Sequence:CCGGGCTCTATTCTCGCTCGGACTTCTCGAGAAGTCCGAGCGAGAATAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003712
VALIDATED
PPAP2C MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2C
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-366s21c1
Sequence:GTACCGGCAACTACGTGGCTGCTGTATACTCGAGTATACAGCAGCCACGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-165s21c1
Sequence:CCGGCGCTATCCTGACGCTGGTGAACTCGAGTTCACCAGCGTCAGGATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-922s21c1
Sequence:CCGGGAGGCTGACCACAACCACTATCTCGAGATAGTGGTTGTGGTCAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003712.2-1225s21c1
Sequence:CCGGGAAGGGACCGAGAGATCAGATCTCGAGATCTGATCTCTCGGTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-824s21c1
Sequence:GTACCGGACATCTCAGACTTCTTCAAAGCTCGAGCTTTGAAGAAGTCTGAGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-165s1c1
Sequence:CCGGCGCTATCCTGACGCTGGTGAACTCGAGTTCACCAGCGTCAGGATAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-329s21c1
Sequence:CCGGTGTACACAGACCGGCTCTATTCTCGAGAATAGAGCCGGTCTGTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003712.2-440s21c1
Sequence:GTACCGGACCTGGCCAAGTACATGATTGCTCGAGCAATCATGTACTTGGCCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-922s1c1
Sequence:CCGGGAGGCTGACCACAACCACTATCTCGAGATAGTGGTTGTGGTCAGCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-1225s1c1
Sequence:CCGGGAAGGGACCGAGAGATCAGATCTCGAGATCTGATCTCTCGGTCCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003712.x-342s1c1
Sequence:CCGGGCTCTATTCTCGCTCGGACTTCTCGAGAAGTCCGAGCGAGAATAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015817
PPAP2C MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015817.1-1414s1c1
Sequence:CCGGGCGACTCTCTTGTCTTTCATTCTCGAGAATGAAAGACAAGAGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-342s1c1
Sequence:CCGGCCGTCTTTATTCGCGATCCAACTCGAGTTGGATCGCGAATAAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-609s1c1
Sequence:CCGGCTTTGGCATGTATTGCATGTTCTCGAGAACATGCAATACATGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-180s1c1
Sequence:CCGGCCTGGTGAATGCACCATATAACTCGAGTTATATGGTGCATTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-354s1c1
Sequence:CCGGGCGATCCAACTTCAACAACTACTCGAGTAGTTGTTGAAGTTGGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015817
PPAP2C MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015817.1-1414s1c1
Sequence:CCGGGCGACTCTCTTGTCTTTCATTCTCGAGAATGAAAGACAAGAGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-342s1c1
Sequence:CCGGCCGTCTTTATTCGCGATCCAACTCGAGTTGGATCGCGAATAAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-609s1c1
Sequence:CCGGCTTTGGCATGTATTGCATGTTCTCGAGAACATGCAATACATGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-180s1c1
Sequence:CCGGCCTGGTGAATGCACCATATAACTCGAGTTATATGGTGCATTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-354s1c1
Sequence:CCGGGCGATCCAACTTCAACAACTACTCGAGTAGTTGTTGAAGTTGGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015817
PPAP2C MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015817.1-1414s1c1
Sequence:CCGGGCGACTCTCTTGTCTTTCATTCTCGAGAATGAAAGACAAGAGAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-342s1c1
Sequence:CCGGCCGTCTTTATTCGCGATCCAACTCGAGTTGGATCGCGAATAAAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-609s1c1
Sequence:CCGGCTTTGGCATGTATTGCATGTTCTCGAGAACATGCAATACATGCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-180s1c1
Sequence:CCGGCCTGGTGAATGCACCATATAACTCGAGTTATATGGTGCATTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015817.1-354s1c1
Sequence:CCGGGCGATCCAACTTCAACAACTACTCGAGTAGTTGTTGAAGTTGGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)