EMAIL THIS PAGE TO A FRIEND

PPAPDC1B

phosphatidic acid phosphatase type 2 domain containing 1B

104 Gene Product Result for
Synonyms: DPPL1 HTPAP
UniProtKB ID: Q8NEB5, Q3KQX6, Q9BY45
Gene ID:
Mouse(71910) phosphatidic acid phosphatase type 2 domain containing 1B
Rat(680466) phosphatidic acid phosphatase type 2 domain containing 1B
Zebrafish(431758) phosphatidic acid phosphatase type 2 domain containing 1B
chicken(770752) phosphatidic acid phosphatase type 2 domain containing 1B
domestic cat(101087151) phosphatidic acid phosphatase type 2 domain containing 1B
dog(475585) phosphatidic acid phosphatase type 2 domain containing 1B
sheep(101118758) phosphatidic acid phosphatase type 2 domain containing 1B
naked mole-rat(101704950) phosphatidic acid phosphatase type 2 domain containing 1B
domestic guinea pig(101788587) phosphatidic acid phosphatase type 2 domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_134059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102559 Rosetta Predictions human pricing
NM_001102560 Rosetta Predictions human pricing
NM_032483 Rosetta Predictions human pricing
NM_001109411 Rosetta Predictions rat pricing
NM_028000 Rosetta Predictions mouse pricing
XM_134059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323213 predicted 355
2 SASI_Hs02_00323214 predicted 314
3 SASI_Hs02_00323215 predicted 313
4 SASI_Hs02_00323216 predicted 394
5 SASI_Hs02_00323217 predicted 351
6 SASI_Hs02_00323218 predicted 358
7 SASI_Hs02_00323219 predicted 398
8 SASI_Hs02_00323220 predicted 348
9 SASI_Hs02_00323221 predicted 399
10 SASI_Hs02_00323222 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323223 predicted 308
2 SASI_Hs02_00323224 predicted 494
3 SASI_Hs02_00323225 predicted 466
4 SASI_Hs02_00323226 predicted 313
5 SASI_Hs02_00323227 predicted 394
6 SASI_Hs02_00323228 predicted 376
7 SASI_Hs02_00323229 predicted 361
8 SASI_Hs02_00323230 predicted 203
9 SASI_Hs02_00323231 predicted 538
10 SASI_Hs02_00323232 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359934 predicted 350
2 SASI_Hs02_00359935 predicted 318
3 SASI_Hs02_00359936 predicted 308
4 SASI_Hs02_00359937 predicted 400
5 SASI_Hs02_00359938 predicted 352
6 SASI_Hs02_00359939 predicted 363
7 SASI_Hs02_00359940 predicted 390
8 SASI_Hs02_00359941 predicted 348
9 SASI_Hs02_00359942 predicted 401
10 SASI_Hs02_00359943 predicted 262
11 SASI_Hs01_00087978 predicted 487
12 SASI_Hs01_00087979 predicted 296
13 SASI_Hs01_00087980 predicted 449
14 SASI_Hs01_00087981 predicted 502
15 SASI_Hs01_00087982 predicted 303
16 SASI_Hs01_00087983 predicted 541
17 SASI_Hs01_00087984 predicted 447
18 SASI_Hs01_00087985 predicted 536
19 SASI_Hs01_00087986 predicted 524
20 SASI_Hs01_00087987 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248147 predicted 689
2 SASI_Rn02_00248148 predicted 324
3 SASI_Rn02_00248149 predicted 1074
4 SASI_Rn02_00248150 predicted 740
5 SASI_Rn02_00248151 predicted 639
6 SASI_Rn02_00248152 predicted 1057
7 SASI_Rn02_00248153 predicted 599
8 SASI_Rn02_00248154 predicted 668
9 SASI_Rn02_00248155 predicted 1022
10 SASI_Rn02_00248156 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333088 predicted 827
2 SASI_Mm02_00333089 predicted 846
3 SASI_Mm02_00333090 predicted 818
4 SASI_Mm02_00333091 predicted 199
5 SASI_Mm02_00333092 predicted 334
6 SASI_Mm02_00333093 predicted 517
7 SASI_Mm02_00333094 predicted 324
8 SASI_Mm02_00333095 predicted 741
9 SASI_Mm02_00333096 predicted 200
10 SASI_Mm02_00333097 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285943 predicted 837
2 SASI_Mm01_00285944 predicted 489
3 SASI_Mm01_00285945 predicted 865
4 SASI_Mm01_00285946 predicted 222
5 SASI_Mm01_00285947 predicted 696
6 SASI_Mm01_00285948 predicted 351
7 SASI_Mm01_00285949 predicted 531
8 SASI_Mm01_00285950 predicted 490
9 SASI_Mm01_00285951 predicted 759
10 SASI_Mm01_00285952 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032483
VALIDATED
PPAPDC1B MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2 domain containing 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-324s21c1
Sequence:CCGGCGTCTTTACCAACACAATAAACTCGAGTTTATTGTGTTGGTAAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032483.3-233s21c1
Sequence:CCGGTGATCTTCCTGGCCAAATTTCCTCGAGGAAATTTGGCCAGGAAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032483.3-676s21c1
Sequence:CCGGTGGGCAGATGAATAGCAATAACTCGAGTTATTGCTATTCATCTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-165s21c1
Sequence:CCGGCTACGTGGAGGCGGAGTATTTCTCGAGAAATACTCCGCCTCCACGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-265s21c1
Sequence:CCGGGACACAAGAGACAGCAGACAACTCGAGTTGTCTGCTGTCTCTTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-301s1c1
Sequence:CCGGCGTCTTTACCAACACAATAAACTCGAGTTTATTGTGTTGGTAAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-242s1c1
Sequence:CCGGGACACAAGAGACAGCAGACAACTCGAGTTGTCTGCTGTCTCTTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-171s1c1
Sequence:CCGGAGCCGATGTTTGTTATTGCATCTCGAGATGCAATAACAAACATCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032483.2-558s1c1
Sequence:CCGGCCTTTCTGTCACCTCTACTTTCTCGAGAAAGTAGAGGTGACAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032483.2-443s1c1
Sequence:CCGGCCCAGTGGACATTCTTCCTTTCTCGAGAAAGGAAGAATGTCCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032483
VALIDATED
PPAPDC1B MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2 domain containing 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-324s21c1
Sequence:CCGGCGTCTTTACCAACACAATAAACTCGAGTTTATTGTGTTGGTAAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032483.3-233s21c1
Sequence:CCGGTGATCTTCCTGGCCAAATTTCCTCGAGGAAATTTGGCCAGGAAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032483.3-676s21c1
Sequence:CCGGTGGGCAGATGAATAGCAATAACTCGAGTTATTGCTATTCATCTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-165s21c1
Sequence:CCGGCTACGTGGAGGCGGAGTATTTCTCGAGAAATACTCCGCCTCCACGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-265s21c1
Sequence:CCGGGACACAAGAGACAGCAGACAACTCGAGTTGTCTGCTGTCTCTTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-301s1c1
Sequence:CCGGCGTCTTTACCAACACAATAAACTCGAGTTTATTGTGTTGGTAAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-242s1c1
Sequence:CCGGGACACAAGAGACAGCAGACAACTCGAGTTGTCTGCTGTCTCTTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-171s1c1
Sequence:CCGGAGCCGATGTTTGTTATTGCATCTCGAGATGCAATAACAAACATCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032483.2-558s1c1
Sequence:CCGGCCTTTCTGTCACCTCTACTTTCTCGAGAAAGTAGAGGTGACAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032483.2-443s1c1
Sequence:CCGGCCCAGTGGACATTCTTCCTTTCTCGAGAAAGGAAGAATGTCCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032483
VALIDATED
PPAPDC1B MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2 domain containing 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-324s21c1
Sequence:CCGGCGTCTTTACCAACACAATAAACTCGAGTTTATTGTGTTGGTAAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032483.3-233s21c1
Sequence:CCGGTGATCTTCCTGGCCAAATTTCCTCGAGGAAATTTGGCCAGGAAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032483.3-676s21c1
Sequence:CCGGTGGGCAGATGAATAGCAATAACTCGAGTTATTGCTATTCATCTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-165s21c1
Sequence:CCGGCTACGTGGAGGCGGAGTATTTCTCGAGAAATACTCCGCCTCCACGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032483.3-265s21c1
Sequence:CCGGGACACAAGAGACAGCAGACAACTCGAGTTGTCTGCTGTCTCTTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-301s1c1
Sequence:CCGGCGTCTTTACCAACACAATAAACTCGAGTTTATTGTGTTGGTAAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-242s1c1
Sequence:CCGGGACACAAGAGACAGCAGACAACTCGAGTTGTCTGCTGTCTCTTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032483.2-171s1c1
Sequence:CCGGAGCCGATGTTTGTTATTGCATCTCGAGATGCAATAACAAACATCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032483.2-558s1c1
Sequence:CCGGCCTTTCTGTCACCTCTACTTTCTCGAGAAAGTAGAGGTGACAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032483.2-443s1c1
Sequence:CCGGCCCAGTGGACATTCTTCCTTTCTCGAGAAAGGAAGAATGTCCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134059
VALIDATED
PPAPDC1B MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2 domain containing 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-333s1c1
Sequence:CCGGCCTCGCCAAGTTTCTAAGGAACTCGAGTTCCTTAGAAACTTGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134059.4-739s1c1
Sequence:CCGGCACTGGCAAGATGTGCTAGTTCTCGAGAACTAGCACATCTTGCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-668s1c1
Sequence:CCGGTCTGTGCCTTTCTGTCACCTTCTCGAGAAGGTGACAGAAAGGCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-64s1c1
Sequence:CCGGCTCCTCAAGAACCTATACTTTCTCGAGAAAGTATAGGTTCTTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134059.4-402s1c1
Sequence:CCGGCCTAGCTCTGAATGGTGTCTTCTCGAGAAGACACCATTCAGAGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134059
VALIDATED
PPAPDC1B MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2 domain containing 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-333s1c1
Sequence:CCGGCCTCGCCAAGTTTCTAAGGAACTCGAGTTCCTTAGAAACTTGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134059.4-739s1c1
Sequence:CCGGCACTGGCAAGATGTGCTAGTTCTCGAGAACTAGCACATCTTGCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-668s1c1
Sequence:CCGGTCTGTGCCTTTCTGTCACCTTCTCGAGAAGGTGACAGAAAGGCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-64s1c1
Sequence:CCGGCTCCTCAAGAACCTATACTTTCTCGAGAAAGTATAGGTTCTTGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134059.4-402s1c1
Sequence:CCGGCCTAGCTCTGAATGGTGTCTTCTCGAGAAGACACCATTCAGAGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134059
VALIDATED
PPAPDC1B MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2 domain containing 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-333s1c1
Sequence:CCGGCCTCGCCAAGTTTCTAAGGAACTCGAGTTCCTTAGAAACTTGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134059.4-739s1c1
Sequence:CCGGCACTGGCAAGATGTGCTAGTTCTCGAGAACTAGCACATCTTGCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-668s1c1
Sequence:CCGGTCTGTGCCTTTCTGTCACCTTCTCGAGAAGGTGACAGAAAGGCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134059.4-64s1c1
Sequence:CCGGCTCCTCAAGAACCTATACTTTCTCGAGAAAGTATAGGTTCTTGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134059.4-402s1c1
Sequence:CCGGCCTAGCTCTGAATGGTGTCTTCTCGAGAAGACACCATTCAGAGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)